
Nachrichten Covid19

diese Seite, März erstellt 2020, sammelt Tipps und Nachrichten über die Pandemie Covid-19 durch das Virus verursacht SARS-CoV-2.

In den kommenden Jahren wird diese Seite sicherlich veraltet und nicht mehr aktualisiert, aber immer noch wir in Erinnerung an dieser wichtigen historischen Periode verlassen.

Sehen Sie sich die Leistung von Covid19 an

Es gibt Internetseiten, auf denen der Fortschritt der Covid-19-Pandemie insgesamt angezeigt wird Nationen der Welt und in Regionen und Provinzen Italiens.

Die Dateien, die die Rohdaten enthalten, aktualisiert jeden 24 Stunden von Universität John Hopkins und von der Katastrophenschutz Italienisch, werden in Open Source am veröffentlicht GitHub mit folgenden Adressen: Nationen bestätigt, Nationen-Todesfälle, Von Nationen wiederhergestellt, Daten-Italien, Daten-Regionen, Daten-Provinzen.

Deshalb haben wir eine Anwendung geschrieben, um die Daten dieser Dateien eingehend zu untersuchen, sowohl mit Grafiken als auch im Textformat.

Diese Anwendung ist ein gutes Beispiel für die Anzeige von Daten in verschiedenen Formaten (lineare und logarithmische Skalen sowie verschiedene Arten von Grafiken und Tabellen), So kann es als Beispiel und als Grundlage für die Erstellung ähnlicher Anwendungen verwendet werden, selbst wenn die Covid19-Pandemie vorbei ist.

Theremino Covid19 V1.3

Mit unserer Anwendung können Sie alle Informationen auswählen und anzeigen,
während Internet-Zuschauer nur einen Teil davon zeigen.

Theremino Covid19 V1.3 Chart1 Theremino Covid19 V1.6 Chart3

Die Vergleichsgraphen zeigen die Unterschiede zwischen den verschiedenen Nationen der Welt und zwischen den italienischen Regionen.
Sie können die Maus oder das Rad in diesen Diagrammen verwenden, um die zeitliche Entwicklung der Daten zu verfolgen.

Notieren Sie sich 24/04/2020

In diesen Tagen in Italien (und auch in anderen Ländern der Welt) Industrielle setzen sich dafür ein, alles wieder zu öffnen, Durch die Untersuchung der Daten kann jedoch festgestellt werden, dass in vielen Regionen die Neuinfektionen und die Anzahl der Todesfälle pro Tag nicht gesunken sind. Wir sind mehr oder weniger am Maximalpunkt der Kurve und Monate sind bereits vergangen.

Wegen der Gier der Industriellen haben wir ein falsches LockDown gemacht, mit der 66.7% der sich bewegenden nationalen Belegschaft (Siehe die ersten Zeilen der Seite 8 davon Inail-Dokument) und wir haben eine große Anzahl von Todesfällen verursacht, die hätten auftreten könnenuti vermeiden, finden Sie unter In diesem Abschnitt.

Wenn wir weiterhin dumm sind, werden die Prozentsätze nicht nur nicht auf Null fallen, aber sie werden wieder aufstehen und wir werden es bis Weihnachten haben. Und sag das wenn wir alles schließen würden, wie die Chinesen, wir könnten in nur einem Monat auf fast Null fallen.

Aktualisieren von der “nach Weihnachten”
Der vorherige Satz, geschrieben vor fast einem Jahr, er sagte “bis Weihnachten”. Dann schien es übertrieben, aber hier sind wir, im Januar von 2021, noch schlimmer gemacht als letztes Jahr. Im Namen von “Gott Geld” wir haben viel rausgenommen’ von Großeltern und wir gaben dem Virus auch Zeit, eine weitaus infektiösere Variante des ursprünglichen Virus zu entwickeln. Also jetzt wer auch immer wollte “Geld verdienen” Er hat zehnmal mehr verloren und wird weiterhin verlieren, und es passt gut zu ihm!

Einfache Anweisungen

  • In den vier Feldern oben können Sie das Land auswählen, die Region, die Provinz und die Art der anzuzeigenden Daten.
  • Bewegen Sie den Mauszeiger über den vertikalen Bereich links, um die vertikale Skalierung anzupassen, Drücken Sie die linke Maustaste und bewegen Sie die Maus auf und ab.
    – Durch Drücken der Maus in der oberen Hälfte der vertikalen Skala wird der Maximalwert angepasst.
    – Durch Drücken der Maus auf die untere Hälfte der vertikalen Skala wird der Mindestwert angepasst.
  • Um die horizontale Skala anzupassen, drücken Sie die linke Maustaste auf der unteren Skala und bewegen Sie die Maus nach links und rechts.
  • Die beiden Skalen können eingestellt werden (vertikal und horizontal) sogar mit dem Mausrad, Platzieren Sie den Cursor auf der vertikalen Skala, auf der horizontalen oder sogar auf der Grafik.
  • Verschieben des angezeigten Zeitraums nach links und rechts, Drücken Sie die linke Maustaste in der Mitte des Diagramms und bewegen Sie die Maus nach links und rechts.
  • Die blaue Linie “Durchschnittlicher Anstieg” repräsentiert die täglichen Anstiegsdaten, in den letzten sieben Tagen vermittelt. Wir haben die Rohdaten für die Erhöhung zwischen einem Tag und dem vorherigen Tag nicht verwendet, weil sie zu gezackt und daher schwer zu interpretieren wären.
  • Die grüne Linie “Todesfälle insgesamt”, repräsentiert den Prozentsatz der Todesfälle, als die Gesamtzahl der Fälle.
  • In den Vergleichstabellen (“Bestätigt und Tod”, “Bestätigt und Incr”, “Todesfälle und Inkremente”, “Fälle und Todesfälle”, “Fälle und Inkremente”, “Todesfälle und Erhöhungen”), Sie können den Tag mit dem Mausrad ändern, oder indem Sie die linke Maustaste in der Grafik drücken und die Maus nach links bewegen.
  • In den Vergleichsgraphen ist es auch möglich, die Skala während des Tageswechsels zu sperren.
  • In den Vergleichsdiagrammen können Sie eine Region markieren, indem Sie mit der Maus darauf klicken. Dann, um zum normalen Diagramm zurückzukehren, Klicken Sie auf den markierten Bereich.
  • In den Vergleichsgraphen können Sie die rechte Maustaste drücken und die Nationen deaktivieren (oder Regionen) das ist egal. Durch die Deaktivierung einiger Nationen “abnormal”, zum Beispiel Katar, die anderen können besser gesehen werden.
  • In den Vergleichsgraphen der Nationen der Welt erscheint ein Feld, in dem die Anzahl der anzuzeigenden Nationen ausgewählt wird. Durch die Verringerung der Anzahl der Länder werden diejenigen mit wenigen Fällen ausgeschlossen, die oft Datenfehler haben, oder Daten, die nicht dem Standard entsprechen. Zum Beispiel Katar, was sich als eine große Anzahl von Fällen herausstellt, erweitert die Skalierung des Diagramms und komprimiert alle anderen Länder.
  • Im Anwendungsordner befindet sich die neue Datei “Population.txt”, die die Anzahl der Einwohner der Nationen der Welt und der italienischen Regionen enthält. Wenn Sie diese Datei nicht bearbeiten, oder wenn die Datei nicht existiert, dann die Daten aus dem 2019 in der Anwendung selbst geschrieben.

Hinweise für Versionen

Version 1.0 – Die Anwendung ist voll funktionsfähig, aber in den nächsten Tagen werden wir den zentralen Index verbessern, das bewegt sich ein wenig’ Ändern der Vergrößerungsstufe. Wenn wir Zeit haben, werden wir auch andere Optionen für den Datentyp hinzufügen, Zum Beispiel der Prozentsatz der Todesfälle im Vergleich zur Anzahl der Infizierten.
Version 1.1 – Wir haben einige kleine Mängel behoben und den Prozentsatz der Todesfälle zur Gesamtzahl der Fälle addiert. Mit dem neuen Parameter haben wir festgestellt, dass in der Lombardei der Anteil der Todesfälle weitaus höher gestiegen ist als im übrigen Italien, er ist jetzt bei 18% und geht immer noch hoch, finden Sie unter In diesem Abschnitt.
Version 1.2 – Wir haben die neuen Ansichten hinzugefügt “Bestätigt und Tod”, “Bestätigt und Incr”, “Todesfälle und Inkremente”, “Fälle und Todesfälle”, “Fälle und Inkremente”, “Todesfälle und Erhöhungen”, die nützlich sind, um die Nationen der Welt und die italienischen Provinzen in verschiedener Hinsicht zu vergleichen.
Version 1.3 – Lesbarkeit und Farben haben sich verbessert und wir haben einige kleine Probleme gelöst. Endlich Der Zentralindex bleibt am selben Tag stabil, auch wenn Sie das Diagramm vergrößern oder verkleinern.
Version 1.4 – Kleinere Korrekturen bei der Verwendung der Visualisierung “Originaldaten”.
Version 1.5
– Die Änderung der Tage mit der Maus in den Vergleichstabellen wurde verbessert.
– Möglichkeit hinzugefügt, die Skalierung in Vergleichstabellen zu sperren.
– Tracks hinzugefügt, die das zeigen Trend der letzten Tage in den Vergleichstabellen.
Version 1.6
– Vergleichsdiagramme haben jetzt logarithmische Skalen und zeigen die Unterschiede zwischen Regionen besser.
– Die Vergleichstabellen sind effizienter und Sie können die Tage flüssig mit der Maus scrollen.
Version 1.7
– In den Vergleichsdiagrammen können Sie eine Region markieren, indem Sie mit der Maus darauf klicken.
– Klicken Sie auf den markierten Bereich, um zum normalen Diagramm zurückzukehren.
Version 1.8
– Der Fehler, der bei den Quatar-Daten aufgetreten ist, wurde behoben
– Es wurde die Möglichkeit hinzugefügt, die Anzahl der in den Vergleichstabellen angezeigten Länder zu ändern.
Version 1.9
– In den Vergleichsgrafiken können Sie die rechte Maustaste drücken und die Länder deaktivieren, die nicht von Interesse sind.
Version 2.0
– Es wurden Diagrammtitel mit Namen von Ländern und Regionen hinzugefügt.
Version 2.1
– Die Vergleichsgraphen der italienischen Regionen funktionierten nicht mehr, da der Katastrophenschutz das Format der Daten geändert hat.
– Jetzt passen sich die Grafiken automatisch an die neuen Formate an.
Version 2.2
– Die horizontale Position des Felds für die Ländernummer wurde korrigiert
– Mausrad, das auch auf Computern funktioniert, die das Flag nicht gesetzt haben “Inaktive Fenster scrollen”
– Num-Nations-Fehler mit LockScale behoben
– Nationen auch in alphabetischer Reihenfolge
– Wenn Sie das Diagramm verschieben, wird die Position in der Liste aktualisiert
– Der Prozentsatz wird jetzt für neue Fälle berechnet
– Wochentage hinzugefügt
Version 2.3
– Sie blockierten das Herunterladen von Dateien, für die ältere Versionen nicht mehr funktionieren
– In der version 2.3 Wir mussten eine andere Methode verwenden, um die Dateien herunterzuladen.
– Manchmal ist die neue Methode langsamer als die vorherige, aber wenn Sie ein schnelles Netzwerk haben, kann sie sogar besser sein als zuvor.
Version 2.4
– Wir haben den ursprünglichen Betrieb wiederhergestellt (Ändern der Transport Layer-Sicherheit von der Version 1.1 in 1.2)
Version 2.5
– Es wurde ein Fehler behoben, der auftrat, wenn die Daten ein Feld mit enthielten “JJJ”
– Ora, beim Ändern der Fenstergröße, Das Diagramm erstreckt sich auch horizontal entsprechend der Größe des Fensters.

Download der Anwendung Theremino_Covid19 Version 2.5
Theremino_Covid19_V2.5_WithSources (für Programmierer)
Für alle Systeme von Windows XP zu Windows 10, Beide 32 die in 64 bisschen (Linux und OSX mit Wein)

Die SARS-Virus-2

Der genetische Code des Virus ist bei weniger als klein 500 Zeilen.

so begann:
und es weiterhin für etwa zehn Seiten.

Es gibt zahlreiche Variationen dieses Codes. Ändern Sie einfach einen einzelnen Buchstaben und der Virus ist nicht mehr derselbe, aber die meisten dieser Mutationen hat keinen Einfluss auf den Betrieb.

Dies ist der komplette Code der Wuhan-Hu-1, einer der ersten, die in China wurden sequenziert:

Dies ist anstelle der COV2 in Italien sequenziert 30 Januar 2020:

Und von hier aus kann man alle anderen herunterladen und auch den phylogenetischen Baum bauen, dass zeigt die Folge von Mutationen, die sie miteinander verbinden:….corona

Codes und Sequenzen

All dies ATTAAAGGTTTATACCTTCCCAGGTAA Machen Sie uns klar, dass ein Virus nichts anderes als ein kurzes Programm ist. Ein wesentlich kürzerer Code der Programme, die wir auf dieser Seite schreiben. Aber auf der anderen Seite ist ein Code, Marken Milliarden von Jahren von Feldtests nutzen und erreichten dann eine unglaubliche Effizienz und unvorstellbare Dinge tun.

Einer der großen Dinge, die diese kleine Kreatur bereits geschaffen hat, zu tun, Er war an den Kopf an die ganze Menschheit zu beugen. Wir tun so verstehen, dass Sie nicht weitergehen kann, und wenn wir die Lektion lernen müssen wir ihm danken.

Vorerst ist die Sprache dieser Sequenzen dort weitgehend unverständlich, aber wir sind auf dem richtigen Weg und wir können bereits einige nützliche Operationen machen.

phylogenetische Analyse
phylogenetische Karte
Mit der Software Open-Source-Nextrain Sie können Hinweise auf die zeitliche Entwicklung des Virus finden.

Beispiel phylogenetische Karte zeigen Mutationen in der SARS-CoV-2 und das hat uns, dass die ersten Versionen etwa bis Dezember reicht zurück zu etablieren erlaubt 2019.

Vergleich der Versionen

Durch Vergleich der Gensequenzen können Sie alle Art gesucht. Zum Beispiel, haben Wissenschaftler der School of Life Sciences an der Universität Peking und dem Institut Pasteur von Shanghai, unter der Aufsicht der chinesischen Akademie der Wissenschaften, Sie behaupten, die Existenz von zwei Versionen von SARS-CoV-2 haben entdeckt.

In ihrer Studie, veröffentlicht am National Science Bewertung, die Zeitung der gleichen chinesische Akademie der Wissenschaften, veranschaulichen die zwei unterschiedlichen Arten dieses Virus: eine definierte Typ-L, der andere Typ-S.

Laut ihrer Studie die erste, der Typ-L, Es war viel mehr ansteckend und tödlich des zweiten.

DIY Ausrüstung

Behandeln Sie die DNA wird immer einfacher, bis zu dem Punkt, dass einige Geräte (zum Beispiel für die Kettenreaktion der DNA-Polymerase) Sie sind auch konstruierbar “DIY”, Hier ist ein Beispiel: Simple-PCR

erstellen Sequenzen

Auch neue Sequenzen erstellen und sie in reale Körper drehen wird immer einfacher. Mit synthetischen biology Gene werden von Grund auf neu erstellt: “Geben Sie die ??DNA Sie wollen, drucken Sie es aus und in Hefe transformiert”. In der letzten Jahren für ein durchschnittliches Labor, auf Bestellung individuelle DNA-Sequenzen aus einer Synthese Unternehmen hat es eine Routineaufgabe geworden: Sequenzen werden in einem Online-Formular eingefügt und Empfangen von Mail für ein paar Tage nach der DNA.

Natürlich können Sie dies nur mit harmlosen Organismen wie Hefen. Um das Virus zu behandeln sollten Teil eines zertifizierten Labor sein mit Biosicherheitsstufe 3 oder 4.

Gefährliche Technologien

Im vorigen Kapitel haben wir gezeigt, dass Chaos mit den genetischen Sequenzen immer einfach und für jedermann erschwinglich.

Biological LaboratoriesUnd es ist noch einfacher zu biologischen Waffen Labors zu entwickeln.

Diese Laboratorien sowie die modernsten Techniken zur Sequenzierung und Synthese, Gebrauch machen von Super-Computer, die Milliarden von Mutationen pro Sekunde zu schaffen.

Und der Computer kann auch Mikroorganismen mit Techniken ähnlich denen der natürlichen Selektion simulieren und wählen.

Deshalb ist es ganz einfach zu produzieren Sequenzen auf dem Computer
und dass sie aussehen, natürlich vorkommenden Mutationen, zum Beispiel bei Fledermäusen.

Das Verbot von chemischen und biologischen Waffen, durch das Genfer Protokoll auferlegt bereits 1925, Er hörte nicht auf die Kriegspolitik vieler Länder (vor allem in den USA), das geht offen weiter zu studieren und zu ihrer Herstellung.

Gefahr der Zensur

Und’ vorhersehbar, dass jemand Gesicht Einwände auf unserer rechten Ideen vorzuschlagen. Zum Beispiel gibt es eine “Kreuz Pakt für die Wissenschaft” unter Verwendung von Methoden unwissenschaftlich (Beschwerden an die Justiz) auf obskure Websites, die Ideen, die sie veröffentlichen, mag sie nicht. Dies “Pakt” Es wurde von Burioni, Unified Network Televirologist, der in 2009 es ist nicht einmal in der Lage einen öffentlichen Wettbewerb passieren (mit nur 9 Gesamtteilnehmer, selbst eingeschlossen) alle’Universität von Camerino, für den Posten des “Universitätsprofessor”. und in 2010 Es wurde auch abgelehnt’Universität Catanzaro und von der Sapienza University of Rome.

Hier sind einige Links, die auf Burioni informieren und ihre “Pakt”: LINK_1, LINK_2, link_3, link_4, link_5, link_6, LINK_7 (interessanter Link 7, die seziert das Buch Burioni und seine Aussage “Die Wissenschaft ist nicht demokratisch”).

Die wirklichen Wissenschaftler nicht verwenden Fernsehen, die Beschwerden und Beschwerden, forschen im Labor und dann veröffentlichen die Ergebnisse. Sie werden dann andere Wissenschaftler, und nicht die Öffentlichkeit von Barbara D'Urso, Beurteilen, ihre Ideen mit “Peer-Review”. doch Burioni (Sie verstehen nicht, wie) Er hat schon teilweise in seinem Ziel inquisitorischen gelungen, zumindest auf soziale Smartphones. Zum Beispiel, wenn Sie die link_4 mit öffnen WeChat, der Ort der Radio Radio TV ist gesperrt und erscheint Diese Zensur Nachricht.

Da die Gefahr, dass die früheren Verbindungen ist zensiert, Hier sind die Links zu herunterladbaren Videos von einer alternativen Quelle: LINK1, LINK2, LINK3, LINK4, link5

Therapie “DIY”

Zunächst einmal ist es wichtig, dass wir zu klären wir verkaufen nichts,
wir aussetzen nur Ideen, kann oder auch nicht wie, aber sie sind nur Ideen.

Es ist auch wichtig zu bedenken, dass
Jeder hat das Recht dazu
verteidigen ihr Leben mit allen Mitteln,
selbst in dem Fall, dass diese Mittel nicht “offiziell anerkannt”.

Derzeit haben Vertrauen in der Medizin kann tödlich sein, sowohl das Risiko von in Krankenhäusern infiziert zu werden, und weil die Mehrheit der Covid-19-Kranken erhalten nicht die notwendige Sorgfalt. Die meisten von ihnen sterben auf dem Flur, oder zu Hause, oder auf einer Bahre, oder eine ganze Nacht auf einem Stuhl, ohne auch nur in der Lage, auf die Toilette zu gehen (außer Betrieb), kein Papagei (niemand wäscht sie), ohne Intensivmedizin, ohne Sauerstoff… finden Sie im nächsten Kapitel Video.

Wir beschuldigen niemanden, in der Tat sind wir aufrichtig dankbar
für die Opfer, machen sie Ärzte und Krankenschwestern, Danke!

Aber wir sind auch daran interessiert, das Recht zu verteidigen fend durch irgendwelche Mittel,
wenn Erleichterung nicht ankommen, oder wurden zu alt beurteilt, um sie zu verdienen.


Hier sind einige Erfahrungsberichte über das Ende machten sie Zehntausende von Menschen im letzten Monat. Menschen, die gegeben haben ihr Leben, mit Zuversicht, zu denen, die sie nicht retten konnte:

SiroMarchesi, Genua, Medici, SanRaffaele, GiovanniBosco, Aniñón, Cartabianca, Piedmont, Italiano_in_Cina

Italiener, die sterben, nicht für das Virus, aber wegen des Mangels an Pflege oder Langsamkeit, Ich bin zur Zeit etwa sechs von zehn Todesfällen, so gut 500 täglich (31 März 2020). Diese Daten können leicht gesteuert werden, indem die Sterblichkeit erhöhen Berechnung hat es in Italien gewesen, nach Katastrophenschutzdaten und der Weltgesundheitsorganisation. Hier ist, wie:

  • Erstmals im März 2020 – 1577 Total und infizierte 34 Todesfälle – dann 2% von Todesfällen
  • 10 März 2020 – 10149 Total und infizierte 631 Todesfälle – dann 3% von Todesfällen
  • 20 März 2020 – 47021 Total und infizierte 4032 Todesfälle – dann 9% von Todesfällen
  • 31 März 2020 – 105792 Total und infizierte 12428 Todesfälle – dann 12% von Todesfällen
  • 15 April 2020 – 165155 Total und infizierte 21645 Todesfälle – dann 13% von Todesfällen
  • 10 Mai 2020 – 219070 Total und infizierte 30560 Todesfälle – dann 14% von Todesfällen

Wie aus den Daten ersichtlich, Frühletalität März war 2%, ähnlich dem von China, Deutsch und amerikanische. Dann Sterblichkeit hat sich zu 14% (und steigt weiter an, Notiz von 10 Mai 2020).

Und in einigen Regionen ist es sogar noch größer, Hier sind zum Beispiel die Konten für die Lombardei:

  • Erstmals im März 2020 – 984 Total und infizierte 24 Todesfälle – dann 3% von Todesfällen
  • 10 März 2020 – 5791 Total und infizierte 468 Todesfälle – dann 8% von Todesfällen
  • 20 März 2020 – 22264 Total und infizierte 2549 Todesfälle – dann 11% von Todesfällen
  • 31 März 2020 – 43208 Total und infizierte 7199 Todesfälle – dann 17% von Todesfällen
  • 15 April 2020 – 62153 Total und infizierte 11377 Todesfälle – dann 18% von Todesfällen

Diese Daten beziehen sich nur auf Italien und werden auf die gleiche Weise innerhalb weniger Wochen erhoben (sehen Sie hier). So können Sie es auf verschiedenen Bewertungsmethoden zwischen den Ländern nicht verdenken. Auch Sie können von anderen Faktoren denken, so hoher Anteil älterer oder genetischen Variationen.

Die Sterblichkeit steigt, wenn keine Plätze mehr frei sind, Atmungs- und Sauerstoff zu allen. Auch von offiziellen Quellen bestätigt, sowie von Ärzten, Krankenschwestern und Patienten, siehe die Videos vorgeschlagen oben.

Was passiert, wenn Erleichterung nicht ankommt

Wie im vorhergehenden Kapitel gezeigt, (wenn Sie nicht bereits getan haben Viedeo), eine große Anzahl von Menschen jeden Tag sterben, weil Sauerstoff nicht gefunden wird, Entweder weil es zu spät ist oder weil Sie auf einem Stuhl sitzen bleiben, oder auf einer Trage im Korridor, bis Sie zu ernst werden, um sich zu erholen.

Und selbst wenn die infizierte Wachstum beginnt sich zu verlangsamen, jedoch wird die Mortalitätsrate für Monate erhöhen und schließlich (in wenigen Jahren) Covid-19 muss von fast jedem eingenommen werden. Es ist also gut, sich an die Idee zu gewöhnen, dass jemand in der Familie ist, zwischen Onkel, Großeltern, Brüder und Vettern, früher oder später nehmen.

Und es wird auch einige Familienmitglieder geben, die Schwierigkeiten beim Atmen haben und Sauerstoff benötigen, um die schlimmsten Tage zu überstehen. Es ist also gut, rechtzeitig darüber nachzudenken, bevor es zu spät ist (siehe zum Beispiel der ersten Video unter den im vorhergehenden Kapitel vorgeschlagen).

Bitte schreiben Sie Nachrichten am Ende dieser Seite.
Der Austausch von Erfahrungen können für andere nützlich sein
und in einigen Fällen sogar Leben retten!


Der Superior Health Council hat der Verabreichung von Sauerstoff durch nicht medizinisches Personal und in Dieses Dokument er sagt wörtlich: “Sauerstoff ist kein Medikament, dessen Verabreichung auf einen Arzt oder ein medizinisches Fachpersonal beschränkt ist“.

von Wikipedia: Die Sauerstoffgeneratoren PSA-System sind eine Quelle von kosteneffektiven Sauerstoff. Sie sind sicherer, billiger, und neigen dazu, bequemer zu sein in Bezug auf die kryogene Sauerstofftanks oder die klassischen Flüssigsauerstofftanks. … omissis … Tragbare Sauerstoffkonzentratoren sind in der Heimtherapie bei Patienten mit chronischer Ateminsuffizienz wirksamer: die Flüssigsauerstofftanks (Kinderwagen) Sie haben begrenzte Autonomie, dass Kräfte der Patient in seine Heimat zurückzukehren, nach ein paar Stunden. Die tragbare Sauerstoff-Konzentratoren, anstatt den Patienten ermöglichen, nicht zeitlich begrenzt aussagefähig ist als selbstProduktionsSysteme können mit der Batterie verwendet werden, oder wo auch immer es ist eine elektrische Energiequelle (220V o 12V).

Eine Frage, die wir tun, ist,: “Wie ist es, die tragische Mangel an Zylindern gegeben, die Hunderte von Toten verursacht jeden Tag wird, die NHS Tausende von Sauerstoffkonzentratoren kaufen nicht jemanden zu geben, keinen Platz auf der Intensivstation hat, und das Sterben in den Häusern” ? (diejenigen, die glauben sie nicht an dem Video des vorhergehenden Kapitels Zeugen)

Sauerstoffkonzentratoren sind billig (Von 250 Euro nach oben). Keine professionellen Geräten, aber sie arbeiten und viele Leben retten könnte, hier ist, was es ist:

Modelle Sauerstoffkonzentratoren

Es gibt viele Modelle von Konzentratoren, Hier sind ein paar Beispiele aus den am leichtesten verfügbar und unter dem besten Verhältnis zwischen Qualität und Preis.

Bitte schreiben Sie Nachrichten am Ende dieser Seite.
Der Austausch von Erfahrungen können für andere nützlich sein
und in einigen Fällen sogar Leben retten!



Dieses Modell kostet weniger als 200 Euro (aus China), aber es ist wirklich klein (35 x 23 x 28 cm). Es liefert nur einen Liter pro Minute, daher kann es in schweren Fällen unzureichend sein.

Verbrauchen 125 Watt und es ist ziemlich laut (50 DB).




Dies ist eines der am wenigsten teure Modelle, Sie können es auf eBay finden 239 Euro, inklusive Versand. Die Maße sind von 21 x 21 x 30 cm und wiegt 5.5 Kg

Es produziert 1 in 6 Liter pro Minute (93% Konzentration mit einem Liter pro Minute), verbrauchen 120 Watt und Rauschen sind nicht angegeben.

Der Timer ist einstellbar bis 999 Minuten (16 Stunden).




Dieses Modell kostet ca. 230 Euro + 60 Versand (bei eBay). Die Maße sind von 33 * 20 * 40 cm.

Der Ausgangsfluss geht von 1 in 8 Liter pro Minute, das angegebene Geräusch ist 43 dB und Verbrauch ist 110 Watt.

Natürlich, wie alle Kleingeräte, kommt zu 93% nur Sauerstoff mit geringen Strömungs (1 Liter pro Minute).



Dieses Modell kostet ca. 290 Euro (bei eBay inklusive Versand). Die Maße sind von 27 x 23 x 30 cm und wiegt 5.8 Kg.

Der Ausgangsfluss geht von 1 Liter pro Minute (93% der Konzentration) bis zu 7 Liter pro Minute bei geringerer Konzentration.

Das Geräusch ist nicht angegeben und der Verbrauch ist von 120 Watt.

Der Timer ist einstellbar bis 999 Minuten (16 Stunden).



Dieses Modell kostet ca. 330 Euro (bei eBay inklusive Versand). Die Maße sind von 34 * 18 * 31 cm

Der Ausgangsfluss geht von 1 in 6 Liter pro Minute, das angegebene Geräusch ist 45 dB und Verbrauch ist 100 Watt.

erreichen 90% von Sauerstoff und nur mit geringen Durchflussraten (1 Liter pro Minute). Der Timer ist mit maximal einstellbar 180 Minuten.




Dieses Modell kostet ca. 400 Euro (bei Amazon inklusive Versand). Die Maße sind von 28 * 18 * 34 cm und wiegt 6.5 Kg.

Der Ausgangsfluss geht von 1 Liter pro Minute, mit der 93% der Konzentration, bis zu 5 Liter pro Minute. Mit 3 Liter pro Minute liefert die 60% der Konzentration.

Das Geräusch ist von 54 dB und der Verbrauch ist von 100 Watt.

Sie geben an, es NICHT länger als acht Stunden hintereinander zu verwenden.




Dieses Modell kostet ca. 270 Euro (ohne Zerstäuber) oder ungefähr 290 Euro (mit Zerstäuber) bei eBay inklusive Versand. Die Maße sind von 36 x 23 x 32 cm.

Der Ausgangsfluss geht von 1 Liter pro Minute (93% der Konzentration) bis zu 5 Liter pro Minute bei geringerer Konzentration.

Lärm ist 45 dB und der Verbrauch ist von 120 Watt. Es gibt einen seltsamen Timer, mit dem sie anzeigen “Zyklus von 15 Minuten innerhalb von zwei Stunden” und dass einige Verkäufer sagen, dass sie sich nicht mit weniger zufrieden geben 5 Minuten, den Kompressor nicht zu beschädigen.



Die chinesische Wirtschafts Konzentratoren haben hervorragende Display und Kontrollen, oft besser als selbst die teuersten Modelle.

Die Anzeige aller Modelle zeigen den Prozentsatz an Sauerstoff, der Fluss in Litern pro Minute und die Stunden und Minuten des Timers.

Die Steuerung ist einfach, fünf Tasten um.

Klicken Sie auf das Bild für eine größere Ansicht




Dies ist die “Philips Respironics EverFlo”, er würde auf Amazon gefunden 600 Euro, aber jetzt “nicht verfügbar”. Es wird von anderen Einzelhändlern und sogar auf eBay, aber zu sehr hohen Preisen, 1500-2000 Euro und darüber hinaus. Die Abmessungen sind 58 x 38 x 24 cm und Gewicht 14 Kg.

Und’ einstellbar von 2 in 5 Liter pro Minute, Es hat ein Rauschen von weniger als 40 dB und verbrauchen 295 Watt.

Es kann bis zu 88% Sauerstoff konzentriert sogar mit der maximalen Reichweite von 5 Liter pro Minute.




Dies ist das Modell “OXY-Relief “, es wird in verschiedenen gefunden Online-Händler für über 800 Euro. Die Abmessungen sind 38 x 35 x 66 cm und Gewicht 25 Kg.

Und’ einstellbar von 1 in 5 Liter pro Minute, Es hat ein Rauschen von weniger als 40 dB und verbrauchen 350 Watt.

Es kann bis all'93% Sauerstoff konzentrieren, aber nicht angeben, in welchem ​​Umfang.


Sauerstoff-KonzentratorDies ist die “KRÖBER”, auch eine der am wenigsten laut der teuersten Modelle, Es kostet etwa 1700 Euro. Die Abmessungen sind 53 x 20 x 52 cm ohne Räder, und Gewicht 16 Kg

Die Eigenschaften sind ausgezeichnet, verbraucht nur 280 nur Watt und verfügt über ein Geräusch 31 DB. Der Volumenstrom ist einstellbar von 1 in 5 Liter pro Minute und hat 30 Tausend Stunden Garantie.

Es kann bis zu 85% Sauerstoff gibt auch bei dem maximalen Durchfluss, wiegt nur 16 kg und auch die USB-Schnittstelle.


Es gibt auch teureren Modelle, zum Beispiel die “Inogen ONE” für über 3000 Euro, mit besonderen Merkmalen, zum Beispiel der Batterie bis 9 Stunden Batterielaufzeit. Eigenschaften, die für Covid-19 Interesse uns wenig.


Es gibt verschiedene Methoden zur Verabreichung von Sauerstoff, von weniger invasiven (ein Doppelrohr, das unter der Nase platziert), bis zur vollständigen Masken oder auch die Taucheranzüge, dass den ganzen Kopf wickeln.

Eine Zwischenlösung, sehr effizient, aber immer noch recht angenehm zu tragen, sind die Mund-Nasen-Masken Sie in den folgenden Bildern sehen. Überraschenderweise ihr Preis ist sehr niedrig, weniger als zwei komplette Rohr und Zubehör Euro. Hier sind einige Links, wo sie zu finden: Link1 Link2

Sauerstoffmaske Sauerstoffmaske mit Reservoir

Die erste Straße links ist einfacher und bequemer zu tragen, aber es hat den Nachteil, mehr zu verlieren als die Hälfte des Sauerstoffs aus dem Gerät Konzentrator erzeugt.

Die auf der rechten Seite, Rufen Sie “Hohe Konzentration Maske”, sendet den Sauerstoff, der während der Ausatmung zu einer weichen Tasche nicht verwendet wird, dann macht es während der Inspiration in größeren Mengen verfügbar. Mit diesem Modell können Sie das Sauerstoff-Konzentrator zu einem geringeren Strömungs einstellen.

Wenn zum Beispiel mit dem einfachen Maske war er den Konzentrator auf das Maximum einzustellen (6 Liter pro Minute), die zweite würde ausreichen, um 2 in 3 Liter pro Minute.

Stellen Sie einen geringeren Strömungs ermöglicht den Konzentrator zur Arbeit besser, verbrauchen weniger, produziert auch eine höhere Konzentration von Sauerstoff und in vielen Fällen weniger laut.

Wie viel Sauerstoff zu verabreichen

Der Superior Health Council hat der Verabreichung von Sauerstoff durch nicht medizinisches Personal und in Dieses Dokument er sagt wörtlich: “Sauerstoff ist kein Medikament, dessen Verabreichung auf einen Arzt oder ein medizinisches Fachpersonal beschränkt ist“.

Es ist jedoch gut, einige Grundregeln zu kennen, um eine längere Überdosierung zu vermeiden, die zu Hyperkapnie führen kann (Atmen Sie so langsam, dass der Kohlendioxidgehalt steigt), oder eine Unterdosierung und daher eine unzureichende Sauerstoffversorgung der Gewebe.

Die Sauerstoffkonzentratoren, die wir in den vorherigen Kapiteln angegeben haben, erzeugen keine hohen Flüsse (6-8 Liter pro Minute) mit Sauerstoff zu 100%, So sind sie auch dann ziemlich sicher, wenn sie für längere Zeit auf Maximum eingestellt sind.

Aber einige Leute (besonders starke Raucher) chronische Bronchitis haben (BPCO) und daher eine sehr niedrige übliche Sättigung (88-92%). Diese Leute, in Gegenwart einer Sättigung höher als 92-95%, Sie beginnen zu langsam zu atmen und eliminieren daher Kohlendioxid nicht in ausreichenden Mengen.

Es wäre daher nützlich, ein Pulsoximeter oder Pulsoximeter zu haben (Sie finden sie bei eBay zu einem Bruchteil der Kosten in der Apotheke).

Und es wäre gut, es zu kaufen, bevor Sie Covid-19 unter Vertrag nehmen, um seine übliche Sättigung zu kennen. Im Bedarfsfall wissen Sie also, wie hoch die Sättigung sein sollte.

Bei der Messung mit einem Pulsoximeter sollten die üblichen Sättigungen liegen:

  • COPD-Patient: ideales Sättigungsziel zwischen 88% und 92%
  • Patient ohne COPD: ideales Sättigungsziel zwischen 94% und 98%.

Bei der Messung mit einem Pulsoximeter (Pulsoximeter) Es ist gut, zu einer Sättigung zu neigen, die nicht höher als ist 98% weil diese Geräte nicht die wahre Konzentration im Blut messen und daher ihre Messskala bei stoppt 99%. Für die, wenn Sie es mit Sauerstoff übertreiben, weiterhin punkten 99% und warnen Sie nicht vor dem möglichen Vorhandensein von gefährlich hohem PO2 (130-150 und darüber hinaus) und nicht einmal eine mögliche Ansammlung von Kohlendioxid im Blut.

Sättigung VS PO2

Diese Grafik zeigt, dass die Sättigung mit einem Pulsoximeter gemessen wird (Pulsoximeter) stoppt bei 99-100% auch in Gegenwart von PO2 (arterieller Sauerstoffpartialdruck im Blut) höher als 100.

Abschließend, da wir nicht wahres PO2 im Blut messen können (zu invasiv), Wir müssen auf die oben erläuterten Konzentrationen abzielen (zwischen 88% und 92% für Patienten mit COPD, und dazwischen 94% und 98% für Patienten ohne COPD).


Im Notfall, wenn die Anzeichen von Hypoxie (Sauerstoffmangel) sind offensichtlich, Sie dürfen keine Zeit mit dem Oximeter und den vorherigen Überlegungen verschwenden. In diesen Fällen muss der Sauerstoff maximal reguliert werden, Möglicherweise wird eine Maske mit dem Reservoir verwendet, um die Konzentration weiter zu erhöhen.

Im Notfall sollte so schnell wie möglich dringend Hilfe gesucht werden. Und während Sie auf Hilfe warten, ist es besser, mit Sauerstoff zu übertreiben, weil es mehr schaden würde, wenn du es nicht gibst, anstatt mehr zu geben, auch wenn es nicht nötig war.

Anordnung von Viren Kolonien

Corona Elektronische Mikroskopie

In diesem Bild sehen wir, wie sich das SARS-CoV-2-Virus in großen Mengen auf den Lungenzellen vermehrt, up Atemprobleme zu schaffen.

Wichtig zu beachten, dass die Virus-Kolonien außerhalb der Lungenzellen befinden,
im Bereich der Luft ausgesetzt

Der sichtbare Teil dieses Bildes ist ein Hundertstel so groß wie ein Floh und die orangefarbenen Punkte (i-Virus) Sie haben einen Durchmesser von einem Zehntausendstel Millimeter. SARS-CoV-2-Viren sind kleiner als Photonen (Lichtteilchen, durch die wir sehen) und wir können nicht einmal sehen, wie sie mit dem besten Mikroskop tausendmal vergrößert werden. Also wurde dieses Bild mit einem gemacht Elektronenmikroskop, mit Elektronen anstelle von normalem Licht.

Viren bedecken die Lungenzellen und aufgrund ihrer Position ist es schwierig, sie zu erreichen und durch das Blut zu inaktivieren. Viren sind praktisch außerhalb des Körpers, in dem Bereich, in dem es kein Blut, sondern Luft, und injizierbare Medikamente nicht erreichen sie.

Inaktivierung von Viren

In der folgenden Tabelle sehen wir, dass mit 4 Teile pro Million Ozonviren inaktivieren sich in 20 Minuten.
(Daten aus: Ministerium für Gesundheit – CNSA – Oktober 2010)

Und in der folgenden Tabelle ist ersichtlich, dass es bleibt in Region “ungiftig” auch eine größere Konzentration Atem (5 Teile pro Million), für eine längere Zeit (30 Minuten).
(Daten aus:




In den letzten Monaten haben wir Ideen für eine mögliche Heilung mit Sauerstoff und niedrigen Ozonkonzentrationen vorgeschlagen, Leider ist der Prozentsatz an giftigem Ozon dem wirksamen sehr ähnlich. Auch in letzter Zeit (Mai 2020) Einige gültige und nachgewiesene wirksame Behandlungen wurden entdeckt, Es macht also keinen Sinn mehr, mit diesen Ideen fortzufahren.

Die Möglichkeit der Verwendung von Ozon bleibt jedoch bestehen (und ultraviolett) Räume und Gegenstände zu sterilisieren, wie wir auf den nächsten Seiten sehen werden.


Das größte Problem mit Ozon ist, dass nach dem Befüllen eines Raums mit einer hohen Ozonkonzentration, dann dauert es Tage, um es von Matratzen und Decken raus. Und während dieser Zeit besteht das Risiko, dass die Konzentration immer noch zu hoch ist, um sicher schlafen zu können.

Wie wir im vorigen Kapitel gesehen haben, Wenn Sie längere Zeit in einem Raum mit einem zu hohen Ozonanteil bleiben, können schwerwiegende Symptome und sogar Vergiftungen auftreten. Deshalb bereiten wir einen einfachen und billigen Sensor vor, der den Ozonanteil in PPM misst (Teile pro Million) mit großer Präzision.

AUFMERKSAMKEIT: Verwenden Sie die im Netzwerk vorhandenen Ozongeneratoren
Ohne Messung der Ozonkonzentration kann dies gefährlich sein.

Ein Beispiel für den Ozongenerator:

Ozonsterilisator für Gegenstände

Ein interessantes und sicheres Gerät könnte ein Kleiderschrank zum Sterilisieren von Gegenständen oder Kleidung sein. In diesem Fall würde das Ozon versiegelt bleiben und daher könnte eine sehr hohe Konzentration verwendet werden, Zum Beispiel 100 ppm, womit es in wenigen Minuten eine gute Sterilisation erhalten würde.

In diesem Fall ist Ozon besser als Ultraviolett, da es als Gas auch die Punkte erreichen kann, die im Schatten für Ultraviolett liegen würden.

Dieses Gerät würde bestehen aus:

  • Ein Schrank mit hermetischem und zeitgesteuertem Verschluss.
  • Ein Ozongenerator mit einer Produktion von mindestens 10 Gramm pro Stunde (Sie können sie bei eBay für rund finden 25 Euro).
  • Ein Ozonsensor MQ131.
  • Ein Filter mit Aspirator zum schnellen Extrahieren von Ozon, ohne es in die Umwelt zu bringen.
  • Ein MiniPC, der die Ozonkonzentration misst und die Schließzeit festlegt.
  • Ein Theremino Master-Modul, das den Sensor liest und den Generator steuert, der Aspirator und das Magnetventil zum Schließen der Tür.

Beispiel für eine Zeitberechnung:

  • Ein großer Schrank 50 cm, tief 60 cm und höher 120 cm enthält 360 Liter Luft.
  • Die Luft wiegt ungefähr 1.3 Gramm pro Liter für die 360 Liter tun 468 Gramm.
  • Einhundert Teile pro Million 468 Gramm tun 0.0468 Gramm.
  • Ein Generator aus 10 Gramm pro Stunde vor 0.16 Gramm in einer Minute.
  • Also zu einer Konzentration von 100 ppm würde weniger als ausreichen 20 Sekunden.
  • Und um zu kommen 1000 ppm würde weniger als ausreichen 180 Sekunden.

Mit einer Konzentration von 1000 ppm schaltet sich darüber hinaus aus 90% von Viren in etwa fünf Sekunden, so konnte eine übermäßige Betriebszeit festgestellt werden, zum Beispiel zwei Minuten, Dies würde erhebliche Sicherheit bieten, ohne den Reinigungszyklus zu stark zu verlängern.

Zusammenfassend könnte ein fünfminütiger Reinigungszyklus verwendet werden, zusammengesetzt aus 90 Sekunden Ozonerzeugung, zwei Minuten Aktivität und neunzig Sekunden Ozonextraktion.


Die Inaktivierung von Bakterien und Viren



Bevor Sie mit dem Lesen fortfahren, empfehlen wir Ihnen, Lesen Sie diese Seiten.

Die Studie, die wir vorschlagen, geschrieben von Pietro Semproni, bietet detaillierte Informationen über die Übertragung von Viren und die durch Ultraviolett verursachten Inaktivierungseffekte.


Der Grad der Inaktivierung durch UV-Strahlung wird direkt auf die UV-Dosis im Zusammenhang angewandt. die Dosierung, ein Produkt von UV-Lichtintensität und die Belichtungszeit, Es wird in der Regel in Mikrojoule pro Quadratzentimeter gemessen, oder äquivalent in Mikrowatt pro Sekunde zum Quadratzentimeter (uW · s / cm 2 ).

Dosierungen zum Töten der 90% Bakterien und Inaktivierung von 90% Einige Viren gehen vorbei 2 in 8 mW pro Sekunde pro Quadratzentimeter. Also, wenn wir zählen 5 mW pro Quadratzentimeter und eine Leistung von 5 Watt, Sie können rund um sterilisiert werden 1000 Quadratzentimeter in einem zweiten.

Berechnung der Wände eines Raumes aus 3 für 4 Meter hoch und 2.5 Meter werden erhalten 350 tausend Quadratzentimeter. Fügen Sie auch die Decke und den Boden hinzu, zu denen Sie gelangen 590 Mila.

Also mit 5 Watt würde die Wände bedecken 350 Sekunden, dh ca. 6 Minuten. Und wenn man auch Decke und Boden berücksichtigt, würde es dazu kommen 590 Sekunden, also knapp zehn Minuten.

Die Wirksamkeit dieser Sterilisationsmethode hängt auch von der Konfiguration der Umgebung ab, Wenn es Hindernisse gibt, hängt die Wirksamkeit von dem Punkt ab, an dem die UV-Lampe positioniert ist. Ein weiteres Problem ist der Staub oder Schmutz, der die Lampe bedecken kann, Reduzierung seiner Wirkung. Darüber hinaus müssen die Lampen in regelmäßigen Zeitabständen jährlich ausgetauscht und gereinigt werden. Eine Steigerung der Wirksamkeit kann durch Verwendung eines Parabolreflektors erreicht werden. Aluminium hat im Vergleich zu anderen Metallen die höchste Reflexionsrate, und es ist sehr nützlich zum Reflektieren von UV-Strahlen.

Die wirksamste Wellenlänge

Keimtötende Wirksamkeit

In diesem Bild können wir sehen, dass Niederdruck-Quecksilberlampen ihre gesamte Lichtleistung genau im Bereich maximaler keimtötender Wirksamkeit und Virusinaktivierung abgeben.

Mehr Informationen über die Wirkung der keimtötenden UV-Strahlung:

Sterilisiereinrichtung ultraviolettem

Wir sind ein Gerät zum Desinfizieren Raum zu gestalten (Mauerwerk, Griffe, Etagen, Geld, Objekte, Betten, Thermometer etc ..) mittels ultravioletten, eine Art Xenex aus 120 tausend US-Dollar, aber viel leichter, Wirtschafts- und einfach zu handhaben.

Hier sind zwei Links, die den Xenex zeigen, eine Kabine so schwer und unbequem, die es unmöglich macht, einige Bereiche zu sterilisieren, zum Beispiel unter den Betten und anderen Oberflächen, die im Schatten bleiben:

Die Appliance, die wir entwerfen, ist leistungsstärker als XENEX, aber Griffe wie ein Staubsauger, und erlauben (in einer vertrauten und integralen Overall Person) desinfiziert völlig ein Krankenhauszimmer in weniger als zehn Minuten.

Berechnungen zufolge dauert die Desinfektion eines großen Raums etwa zehn Minuten 5 Uhren bei UVC. Also die große Version, für Krankenhäuser, es könnte eine Macht haben (verbraucht) von 36 oder 44 Watt und eine Ausbeute von ca. 12 oder 15 Watt in einem UVC 260 NM.

Ausgehend von der doppelten oder dreifachen Leistung haben wir einen guten Spielraum, um die allmähliche Erschöpfung der Lampe und andere Ungenauigkeiten bei der Positionierung oder den Anwendungszeiten auszugleichen.

Diese Version sollte auch einen Computer und einen Abstandssensor enthalten, damit der Bediener alle Bereiche des Raums zum richtigen Zeitpunkt abdecken kann.

Diese Version könnte ein paar tausend Euro kosten.

Wirtschaft Version

Man könnte auch denken und eine reduzierte Version mit ein paar Watt UVC-Emission und ohne Computer. Diese billigere Version könnte zu Hause nützlich sein, Geld zu sterilisieren, Geldbörsen und andere Gegenstände.

Aber setzte in den Händen der Verbraucher könnte ein Gerät eine schlechte Idee, angesichts seiner Gefährlichkeit. Ein Verbrauchergerät sollte CE-zertifiziert sein, aber die CE-Kennzeichnung für seine Natur bescheinigt “Unschädlichkeit” ein Produkt, und in diesem Fall haben wir nicht besitzen. Dieses Gerät ist sehr gefährlich, und muss sein.

Natürlich diejenigen, die für sich selbst bauen würde würde diese Probleme nicht haben, Wir werden sehen…

Entwerfen der UVC Sterilisator

Wir haben festgestellt, dass Niederdruck-Quecksilberlampen wesentlich effizienter und kostengünstiger sind als LEDs, für die wir das Projekt modifizieren.

LED_Xenon_IrradianceDies sind NICHT die Xenonlampen, die von der XENEX-Appliance verwendet werden und die uns wegen ihrer schlechten Effizienz getäuscht haben. Öffnen Sie das Bild auf der Seite, die zeigt, dass Xenonlampen etwa zehnmal weniger effizient sind als LEDs (bei der Wellenlänge, die uns interessiert, Viren zu inaktivieren).

  • Effizienz von Xenonlampen : weniger als 0.5%
  • LED-Effizienz von 260 NM : weniger als 2%
  • Wirkungsgrad von Niederdruck-Quecksilberlampen : jenseits der 30%


Wie im obigen Bild zu sehen ist, geben Quecksilberlampen mit niedrigem Druck fast ihre gesamte Energie in einer einzigen Linie um die 254 NM.

Außerdem, im Gegensatz zu Xenonlampen, Diese Lampen produzieren kein Ozon. So kann ein Bediener viele Räume hintereinander ohne Vergiftungsgefahr desinfizieren.

Schließlich haben diese Lampen einen Wirkungsgrad von 30%, so mit 18 Verbrauch Watt produzieren 5.5 UVC-Watt konzentrierten sich alle genau auf die Wellenlänge, die den maximalen Virusinaktivierungseffekt aufweist. Von hier können Sie die herunterladen OSRAM DataSheet von 18 Watt

– – – – –



Um einen ausreichend handlichen Emissionskopf zu erhalten (breit ca. 10 cm und lang ca. 25 cm) Wir müssen zwei oder drei Lampen von verwenden 18 Watt nebeneinander, anstelle eines da 36 oder 55 Watt das wäre zu lang (über einen halben Meter).

Daher erscheinen die am besten geeigneten Lampen “OSRAM HNS L. 18 W 2G11” oder ihre Äquivalente “PHILIPS TÜV PL-L 18 Watt”.



Wir fahren mit dem Desinfektionsprojekt fort. Möglicherweise können wir dies mit den folgenden Funktionen tun:

  • Voll tragbar, ohne die Nachlaufbasis und das Netzwerkkabel.
  • Austauschbare Lithiumbatterie von 2 Kg, für drei Stunden aktiven Betrieb (zwanzig große Krankenzimmer)
  • Angemessene Kosten.
  • Mit ca. 100 Euro Material kann erhalten werden 15 Uhren bei UVC (einen Raum abdecken 4 x 3 x 2.5 Meter weniger als 3 Minuten).
  • Mit anderen 100 Über Euro kommen der Mini-PC und der Abstandssensor hinzu.
  • Andere 100 Für jede austauschbare Energiebank werden Euro benötigt (Von 12 Volt und 150 Wattstunde).
  • Also mit dem Bau, Tests und Kosten sollten in Tausend Euro liegen.


  • MiniPC, der die richtigen Entfernungs- und Zeitverhältnisse berechnet und dem Bediener hilft, die Bereiche nicht zu vergessen (Griff, Mauerwerk, schraffierten Flächen unter Betten, etc.…)
  • Ultraschall-Abstandssensor, der dem Bediener hilft, die richtige Kombination aus Abstand und Zeit beizubehalten.
  • Das ThereminoMaster-Modul, das den Sensor und den Abstandssensor liest, liest einen Knopf am Griff und schaltet die Lampen ein und aus .
  • Ein bis drei Niederdruck-Quecksilberlampen (Die Zeiten werden bis zu dreimal reduziert).
  • Vorschaltgeräte von 12 Volt und 18 Watt, eine für jede Lampe.

Komponentenbilder (Klicken Sie auf die Bilder, um zu vergrößern):

Lampe von 18 Watt ohne Ozonproduktion, “OSRAM HNS L. 18 W 2G11” das Äquivalent “PHILIPS TÜV PL-L 18 Watt”.

Breite 10 cm und Länge ca. 25 cm, so könnten zwei oder drei nebeneinander in einem vernünftig großen Emissionskopf platziert werden. Die Kosten für drei Lampen plus drei 2G11-Fassungen und drei Vorschaltgeräte “Ballast”, wandert herum 100 Euro.


Vorschaltgerät 12v 18wZubringer “Ballast” Von 18 Watt, mit Netzteil a 12 Volt (Von 10 in 15 Volt) und 1.6 Ampere. Effizienz der 90% und Kosten von rd 5 Euro bei eBay.

Die Vorschaltgeräte könnten sich im ersten Teil des Griffs befinden, um das Gewicht des emittierenden Kopfes auszugleichen.

MiniPC mit Windows 10
Ein Z85 MiniPC mit Windows 10, in einen Rucksack auf dem Rücken gelegt, zusammen mit dem Akku und kleinen Steuerungskomponenten.

Die Kosten für den MiniPC, einschließlich auch kleiner elektronischer Komponenten (Haupt- und Abstandssensor) wandert herum 100 Euro.


Power Bank 150 WattstundeFertiger Akku (mit CE-Zertifizierung), oder Sie können es mit Lithiumbatterien und Lademodulen bauen, die Sie bei eBay finden.

Es gibt zahlreiche ähnliche Kraftwerksmodelle. Modelle von 150 Wattstunden kosten etwas mehr als 100 Euro, deshalb ist es besser, sie schon gemacht zu kaufen.

Mit 150 Wattstunden speisen drei Lampen ab 18 Watt (mehrere PCs und Elektronik) seit über drei Stunden. So können vor dem Batteriewechsel zwanzig Räume geschaffen werden.

– – – – –


Wenn jemand vorschlagen, dieses Gerät zu produzieren
wir werden kostenlos beitragen
mit der Gestaltung der Steuerelektronik und Software-Entwicklung.

– – – – – –

Wir veröffentlichen das Projekt “Sterilisator ultravioletter” Vorrang zu nehmen und verhindern, dass jemand es Patentierung.

Wir sind immer für den freien Verkehr von Wissen (finden Sie unter Diese Seite) und wir haben nicht die Absicht, diese Idee zu patentieren. Allerdings ist diese Veröffentlichung macht “Kunst-Hinweis”, es im Jargon der Patentämter zu setzen, und deshalb werden wir immer Vorrang haben und die Möglichkeit haben, die Gültigkeit eines Patentverlustes zu gewährleisten.

Wenn in Zukunft jemand versucht, es zu patentieren, wir nachweisen können, (durch die Website die heute, die 25 März 2020, Diese Idee wurde bereits veröffentlicht und damit in der Public Domain.


Mask_OutsideSie sollten ein jedes Mal, wenn Sie das Haus verlassen Maske tragen, und dies wird in den kommenden Monaten noch wichtiger geworden. heute in vielen Einkaufszentren können bereits nicht einmal ohne Maske erhalten in.

Mit dem corona auf freien Fuß ist gut geeignete Masken zu verwenden,. Doch zu diesem Zeitpunkt gibt es viele falsche Masken um.

Also präsentieren wir 3 einfache Tests, die Qualität der chirurgischen Masken überprüfen.

Eine gute Qualität OP-Maske hat in der Regel drei Schichten, wobei die innerste Schicht, die Feuchtigkeit aufnimmt, die Zwischenschicht, die als ein Filter wirkt und die äußerste Schicht, das Wasser abstößt.

Um die Tests benötigen Sie eine Maske zu opfern. Wir empfehlen daher, am Ende des Tages zu testen, bevor Sie die Maske wegwerfen.

1) Sehtest

Wenn eine Maske 3 Schichten, logisch, sollte 3 Schichten. Wenn Sie es schneiden, sollten Sie sehen 3 sehr offensichtlich Schichten.


Die 3 Schichten bestehen typischerweise aus einem durchscheinenden Stück (nach oben), Weiß (Entfernung zum Zentrum) und bunt (Grün, blu, oder weiß) .

2) Wassertests

OP-Masken, schützen nicht nur andere durch Husten und Niesen, Sie bieten aber auch Schutz vor anderen. Daher, die äußere Schicht ist so konzipiert, wasserdicht zu sein.

Falten Sie die Maske so, dass die Außenseite einen Trichter bildet, und gießen Sie Wasser hinein. Das solltest du sehen können Maske behält Wasser richtig. Nach einer Zeit der Boden des Trichters berührt und stellen Sie sicher, dass es nicht feucht oder nass.

3) Brandtest

Die Zwischenschicht muss ein Filter, kein Stück Papier. Deshalb muss es mit der Flamme eines Feuerzeugs brennen, aber es muss nicht ein normales Blatt Papier Feuer fängt als würde.

Herstellung von Masken

Unser Mitarbeiter in China besuchte eine Firma, die chirurgische Masken herstellt, und überlegte, sie vor Ort vorzuschlagen, auch waren billig, aber leider ist der Zug nach Italien war zu teuer.

So war es eine reale Gefahr, dass die Zahl Wucherer machen, so dass sie beschlossen, sie gehen zu lassen und das einzige, was wir bieten und Video zeigt, wie sie gebaut werden.

– – – – – –

Bitte schreiben Sie Nachrichten am Ende dieser Seite.
Der Austausch von Erfahrungen können für andere nützlich sein
und in einigen Fällen sogar Leben retten!

  1. Marco Brianza sagt:

    Ich interessierte mich für UVC-Sterilisation, Da ich auf aliexpress einige Quecksilber- und LED-UV-Lampen gekauft habe, wollte ich deren Spektrum überprüfen, Ich habe nicht verstanden, ob Ihr Spektrometer bis zu reicht 250 NM.

    • Livio sagt:

      Unser Spektrometer würde auch dazu kommen 50 NM, Aber ich kann Ihnen nicht sagen, ob es WebCams gibt, die UVCs sehen. Wir haben nur wenige ausprobiert, Vor vielen Jahren hatten wir keine UVC-LEDs zum Ausprobieren.

      Sie benötigen das Spektrometer jedoch nicht, Quecksilberlampen haben das Spektrum, das Sie im Bild des Vergleichs mit LEDs sehen, Hier ist der direkte Link:

      Und die LEDs haben die angegebene Frequenz und Sie können vertrauen (wenn Sie sie direkt vom Hersteller kaufen).

      Quecksilberlampen lassen sie fallen, weil sie nicht genug Licht auf sie werfen 260-270 NM, Sie tun es in anderen Bereichen und es ist nutzlos. Also entweder als XENEX (das verwendet sehr teure Lampen, von Tausenden von Euro, und zieht sie mit vielen Kilowatt am Hals) oder du bekommst nichts.

      Bei LEDs besteht das Problem nicht darin, die Frequenz zu messen, sondern die emittierten Milliwatt. Dabei würde Ihnen unser Spektrometer nicht helfen. Der einzige Rat, den ich Ihnen geben kann, ist, die von uns empfohlenen LEDs von den von uns aufgeführten chinesischen Unternehmen zu kaufen.

      Wenn Sie besser als diese LEDs finden, schreiben Sie uns, dass wir auch interessiert sind.

  2. Marco sagt:

    danke für die schnelle antwort,
    Niederdruck-Quecksilberlampen scheinen mir zielgerichtet genug für die Herstellung von UVC zu sein ( Es gibt Varianten mit und ohne Ozon) die Geister hier

    Mein Zweifel ist an der Zuverlässigkeit fertiger chinesischer LED-Produkte, die möglicherweise nicht die richtigen Frequenzen verwenden. deshalb wollte ich sie testen.

  3. Livio sagt:

    Quecksilberlampen (auch wenn es nicht aus den Spektren der von Ihnen angegebenen Seite hervorgeht, weil sie die Emissionen auf den anderen Frequenzen speziell zerkleinert und unsichtbar gemacht haben) Sie geben einen großen Teil ihrer Energie auf Frequenzen ab, die keine keimtötende Wirkung haben. Sie benötigen sie also für die gleiche keimtötende Wirkung 15 mal mehr Watt als mit LEDs.

    Und um einen Watt-Raum schnell zu desinfizieren, braucht man viel, mindestens 300..500 Watt mit LEDs und damit 4500..7500 Watt mit Xenonlampen. Vorausgesetzt, Sie können Lampen dieser Leistung kaufen, ohne ins Elend zu geraten. Und solange Sie darauf vertrauen, sie einzuschalten und zu wissen, dass Sie in wenigen Millisekunden ein Kapital verlieren könnten, falls das Netzteil falsch oder defekt ist.

    Darüber hinaus haben Quecksilberlampen eine kürzere Lebensdauer, Sie sind zerbrechlicher und kosten mehr. Und wenn sie dann kaputt gehen, müssen Sie die gesamte Lampe zu einem Gesamtpreis austauschen. Wenn zehn von hundert LEDs kaputt gehen, haben Sie immer noch die 90% des Lichts.

    Bei chinesischen LEDs haben Sie vielleicht Recht, aber nicht wegen der Hersteller. Ein Verkäufer bei eBay verkauft Ihnen möglicherweise die falschen LEDs. Aber leider auch prüfen, ob die Frequenz stimmt (mit unserem Spektrometer) Sie würden nie sicher sein, welche Milliwatt sie herausbringen.

    Deshalb habe ich Ihnen gesagt, dass der einzig sichere Weg darin besteht, sie direkt bei den Produzenten zu kaufen, vor allem aus “Shenzen Yingfeng Opto-Electronic Co., GmbH” was vorerst am besten scheint.

    Einer aus unserer Gruppe (Löwe) Er ist in China und verhandelt mit Yingfeng. Das Problem besteht nicht nur darin, sie zu kaufen, sondern sie auch auf eine Aluminiumplatine zu löten, um sie an einen Kühlkörper zu koppeln, der die LEDs kühl halten kann (maximal zwanzig Grad über Raumtemperatur) selbst bei Verlustleistung von Hunderten von Watt.

    Sobald es uns gelingt, etwas Gutes zusammenzustellen, werden wir es auf der Website am Ende dieses Abschnitts schreiben:

  4. Marco sagt:

    Ich verstehe nicht, warum Sie über Xenonlampen anstelle von Quecksilberdampflampen sprechen. Aus diesem anderen Diagramm geht hervor, dass die Emission von Niederdruckquecksilber hauptsächlich bei 254 nm liegt Das ist völlig anders als das von Ihnen angegebene Xenon.

    • Livio sagt:

      Weil nur Xenon-Produkte stark genug sind, um keimtötende Wirkungen zu haben. Quecksilberdämpfe geben so wenig UVC-Energie ab, dass es Tage dauern würde, einen Raum zu sterilisieren.

      Lassen Sie uns einige Konten machen:
      – Das Sterilisieren eines Raums dauert etwa zehn Minuten 7 Uhren bei UVC
      – Zu haben 7 Watt UVC braucht es 500 Watt LED mit einer Ausbeute von 1.5 %

      Wenn Sie Quecksilberdampflampen finden, die stark genug sind und zu angemessenen Kosten einen Link zum Datenblatt setzen, werden wir die Konten zusammen wiederholen.

    • Livio sagt:

      Ich hatte mir den von Ihnen gesendeten Link nicht genau angesehen. Gegen Ende gibt es die Leistungsdaten und sie sind auch sehr hohe Leistungen, aber da bin ich’ etwas, das nicht zu mir passt.

      Wenn die mit Quecksilberdampflampen erreichbaren Leistungen wirklich viele Watt betragen, Wie kommt es dann, dass Xenex die sehr teuren und ineffizienten Xenon-Lampen in seinen Leuchten verwendet? 120 tausend US-Dollar ?

      Die im Link angegebenen Watt sind echte Watt UVC-Licht a 370 NM, oder vielleicht diese Werte (in einigen Fällen sogar zehn Watt) Sie werden unterschiedlich gemessen?

      Heute werde ich nach anderen Datenblättern von Quecksilberdampflampen suchen, um diese Zweifel zu klären. Wenn es sich um echte Watt handelt, werden wir die Richtung ändern und die LEDs aus dem Projekt entfernen.

  5. ROBERTO BINI sagt:

    Hallo Livio, Wie immer viele Komplimente für das Engagement, das uns allen zur Verfügung gestellt wurde.
    Wenn Sie über die Tatsache sprechen, dass ein Ozonator nicht für Oberflächen wie Betten geeignet ist, Kissen und verschiedene Stoffe, da das erzeugte Ozon für eine lange Zeit in ihnen eingeschlossen bleiben würde, Ich kann Sie fragen, aus welchen Quellen Sie diesen Hinweis erhalten haben? Ich habe gesehen, dass es zur Desinfektion von Schränken für Autos und öffentliche Verkehrsmittel vorgeschlagen / verwendet wird und eine Halbwertszeit von hat 3 Tage im gasförmigen Zustand, aber es ist angezeigt, nur einige zehn Minuten nach der Behandlung auf die Rekombination in Sauerstoff zu warten.

    • Livio sagt:

      Unser Mitarbeiter Leo hat es in seinem Haus versucht und dann musste er in einem anderen Raum schlafen. Sicherlich hatte er in seinem Fall zu viel und zu viele Stunden produziert, Vielleicht ist es also möglich, das richtige Gleichgewicht zu finden, aber es ist nicht leicht, in die Nase zu gehen.

      Das Problem ist, dass der effektive Prozentsatz (welches in PPM gemessen wird, Teile pro Million) es ist sehr nahe daran, dass es für den Menschen giftig ist.

      Es braucht also einen Ozonsensor MQ131 (Wir werden in Kürze eine Anwendung veröffentlichen, die präzise und stabile Messungen mit MQ-Gassensoren ermöglicht).

      Zur Inaktivierung von Viren sollte eine ausreichende Konzentration und Zeit verwendet werden, aber ohne zu übertreiben, und die Luft in Bewegung halten, mit einem Ventilator, um in allen Punkten des Raumes die gleiche Konzentration zu haben.

  6. Handbuch sagt:

    Hallo an alle,

    Ich habe sofort mit präventiven und/oder Sofortmaßnahmen angefangen, wenn auch nur leichte Symptome auftraten (Halsschmerzen, Störungen “seltsame”).
    Hier ist meins “Rezept”:
    – Jeden Morgen auf nüchternen Magen nehme ich Kaliumascorbat (Askorbinsäure + Kaliumbicarbonat)
    – Mit einem speziellen Sauerstoff-/Ozon-Generator bereite ich eine kleine Menge Wasser vor, die ich dann bei den ersten Anzeichen verwende, indem ich auf diese Weise mit dem Wasser Aerosol mache “aktiviert”. du kannst auch gurgeln und ausspülen!

    Lange vor dem “Pandemie” auch für die normale Grippe habe ich diese Prophylaxe verwendet. Auf diese Weise, sind 4 Ich bin seit Jahren nicht einmal erkältet!

    Neben der Reaktion gibt es auch bewusstes Handeln. Unser Körper, wenn er gesund ist oder ihm geholfen hat, ist in der Lage, mit noch ernsteren Dingen umzugehen als das Coronavirus… abgesehen von Dummheit! Das ist nicht vom physischen Körper.

    Wenn ich mal Details ergänze

Hinterlasse eine Antwort

Ihre e-Mail-Adresse wird nicht veröffentlicht.