Coronavirus

News Covid19

Questa pagina, creata nel Marzo del 2020, raccoglie consigli e notizie sulla pandemia di Covid-19 causata dal virus SARS-CoV-2.

Nei prossimi anni questa pagina sarà sicuramente superata e non più aggiornata, ma la lasceremo comunque in ricordo di questo importante periodo storico.        


Visualizzare l’andamento del Covid19

Esistono pagine internet che visualizzano l’andamento della pandemia Covid-19 in tutte le Nazioni del mondo e nelle Regioni e province dell’Italia.

I file che contengono i dati grezzi, aggiornati ogni 24 ore dalla università John Hopkins e dalla Protezione Civile italiana, sono pubblicati in Open Source su GitHub con i seguenti indirizzi: Nations-Confirmed, Nations-Deaths, Nations-Recovered, Dati-Italia, Dati-Regioni, Dati-Province.

Abbiamo quindi scritto una applicazione per esplorare i dati di questi file in modo approfondito, sia con grafici che in formato testuale.

Questa applicazione è un buon esempio di visualizzazione dei dati in vari formati (scale lineari e logaritmiche e vari tipi di grafici e tabelle), per cui la si potrà usare come esempio e come base per creare applicazioni simili anche quando la pandemia di Covid19 sarà finita.

Theremino Covid19 V1.3

La nostra applicazione permette di scegliere e visualizzare tutte le informazioni,
mentre i visualizzatori su internet ne mostrano solo una parte.

Theremino Covid19 V1.3 Chart1     Theremino Covid19 V1.6 Chart3

I grafici comparativi mostrano le differenze tra le varie nazioni del mondo e tra le regioni italiane.
Si può utilizzare il mouse o la sua rotella su questi grafici per vedere l’evoluzione dei dati nel tempo.

Nota del 24/04/2020

In questi giorni in Italia (e anche in altri paesi del mondo) gli industriali fanno forti pressioni per riaprire tutto, ma esplorando i dati si vede che in molte regioni i nuovi contagi e il numero di morti per giorno non sono scesi. Siamo più o meno nel punto massimo della curva e sono già passati mesi.

Per colpa della avidità degli industriali abbiamo fatto un finto LockDown, con il 66.7% della forza lavoro nazionale in movimento (vedere le prime righe della pagina 8 di questo documento Inail) e abbiamo causato un gran numero di morti che si sarebbero potuti evitare, vedere questa sezione.

Se continuiamo a fare gli scemi le percentuali non solo non scenderanno a zero, ma si alzeranno di nuovo e ne avremo fino a Natale. E dire che se chiudevamo tutto, come hanno fatto i cinesi, potevamo scendere quasi a zero in un solo mese.

Semplici istruzioni

  • Le quattro caselle in alto permettono di scegliere la nazione, la regione, la provincia e il tipo di dati da visualizzare.
  • Per regolare la scala verticale si porta il cursore del mouse sulla zona verticale a sinistra, si preme il pulsante sinistro del mouse e si muove il mouse su e giù.
    –  Se si preme il mouse sulla metà superiore della scala verticale si regola il valore massimo.
    –  Se si preme il mouse sulla metà inferiore della scala verticale si regola il valore minimo.
  • Per regolare la scala orizzontale si preme il pulsante sinistro del mouse sulla scala inferiore e si muove il mouse a destra e a sinistra.
  • Si possono regolare le due scale (verticale e orizzontale) anche con la rotella del mouse, posizionando il cursore sulla scala verticale, su quella orizzontale o anche sul grafico.
  • Per spostare a destra e sinistra il periodo visualizzato, si preme il pulsante sinistro del mouse sul centro del grafico e si muove il mouse a destra e a sinistra.
  • La riga blu “Incremento medio” rappresenta i dati di incremento giornaliero, mediati negli ultimi sette giorni. Non abbiamo utilizzato i dati grezzi di incremento tra un giorno e il precedente, perché sarebbero troppo frastagliati e quindi di difficile interpretazione.
  • La riga verde “Decessi su totale”, rappresenta la percentuale di decessi, rispetto al totale dei casi.
  • Nei grafici comparativi (“Confirmed and Death”, “Confirmed and Incr”,  “Deaths and Increments”, “Casi e Decessi”, “Casi e Incrementi”, “Decessi e incrementi”), si può cambiare il giorno con la rotella del mouse, oppure premendo il pulsante sinistro del mouse sul grafico e muovendo il mouse a sinistra.
  • Nei grafici comparativi è anche possibile bloccare la scala durante il cambio dei giorni.
  • Nei grafici comparativi si può evidenziare una regione cliccandola con il mouse. Poi, per tornare al grafico normale, si fa click sulla regione evidenziata.
  • Nei grafici comparativi si può premere il pulsante destro del mouse e disabilitare le nazioni (o regioni) che non interessano. Disabilitando alcune nazioni “anomale”, ad esempio il Qatar, si possono visualizzare meglio le altre. 
  • Nei grafici comparativi delle nazioni del mondo appare una casella per scegliere il numero di nazioni da visualizzare. Abbassando il numero di nazioni si escludono quelle con pochi casi, che spesso hanno errori nei dati, o dati presi con modalità non standard. Ad esempio il Qatar, che risulta avere un numero di casi enorme, espande la scala del grafico e comprime tutte le altre nazioni.
  • Nella cartella della applicazione c’è il nuovo file “Population.txt”, che contiene il numero di abitanti delle nazioni del mondo e delle regioni italiane. Se non si modifica questo file, o se il file non esiste, allora vengono usati i dati del 2019 scritte nella applicazione stessa.

Note per le versioni

Versione 1.0 – La applicazione è pienamente funzionante, ma nei prossimi giorni miglioreremo l’indice centrale, che si sposta un po’ cambiando il livello di ingrandimento. Se avremo il tempo aggiungeremo anche altre opzioni per il tipo di dati, ad esempio la percentuale di morti rapportata al numero di contagiati.
Versione 1.1 – Abbiamo corretto alcuni piccoli difetti e aggiunto la percentuale di decessi sul totale dei casi. Con il nuovo parametro abbiamo scoperto che in Lombardia la percentuale di decessi è salita ben più in alto che nel resto di Italia, ora è al 18% e sta ancora salendo, vedere questa sezione.
Versione 1.2 – Abbiamo aggiunto le nuove visualizzazioni “Confirmed and Death”, “Confirmed and Incr”,  “Deaths and Increments”, “Casi e Decessi”, “Casi e Incrementi”, “Decessi e incrementi”, che sono utili per confrontare le nazioni del mondo e le province italiane sotto vari aspetti.
Versione 1.3 – La leggibilità e i colori sono migliorati e abbiamo risolto alcuni piccoli problemi. Finalmente l’indice centrale rimane stabile sullo stesso giorno, anche quando si ingrandisce o rimpicciolisce il grafico.
Versione 1.4 – Piccole correzioni quando si utilizza la visualizzazione “Dati originali”.
Versione 1.5
– Migliorato il cambio dei giorni con il Mouse nei grafici comparativi.
– Aggiunta la possibilità di bloccare la scala nei grafici comparativi.
– Aggiunte le tracce che mostrano la tendenza degli ultimi giorni nei grafici comparativi.
Versione 1.6
– I grafici comparativi ora hanno le scale logaritmiche e mostrano meglio le differenze tra le regioni.
– I grafici comparativi sino più efficienti e si possono scorrere i giorni in modo fluido con il Mouse.
Versione 1.7
– Nei grafici comparativi si può evidenziare una regione cliccandola con il mouse.
– Per tornare al grafico normale si fa click sulla regione evidenziata.
Versione 1.8
– Corretto l’errore che si verificava coni dati del Quatar
– Aggiunta la possibilità di cambiare il numero di nazioni visualizzate nei grafici comparativi.
Versione 1.9
– Nei grafici comparativi si può premere il pulsante destro del mouse e disabilitare le nazioni che non interessano.
Versione 2.0
– Aggiunti i titoli dei grafici con i nomi delle nazioni e regioni.
Versione 2.1
– I grafici comparativi delle regioni italiane non funzionavano più perché la protezione civile ha cambiato il formato dei dati.
– Adesso i grafici si adeguano automaticamente ai nuovi formati.

Download della applicazione Theremino_Covid19 Versione 2.1
Theremino_Covid19_V2.1 
Theremino_Covid19_V2.1_WithSources (per programmatori)
Per tutti i sistemi da Windows XP a Windows 10, sia 32 che a 64 bit (Linux e OSX con Wine)    


Il virus SARS-CoV-2

Il codice genetico di questo virus è lungo meno di 500 righe.

Inizia così:
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
e prosegue per una decina di pagine.

Esistono numerose varianti di questo codice. Basta modificare una sola lettera e il virus non è più lo stesso, ma gran parte di queste mutazioni non modifica il suo funzionamento.

Ecco il codice completo del Wuhan-Hu-1, uno dei primi che sono stati sequenziati in Cina:
CompleteGenome-Wuhan-Hu-1

Questo è invece il Cov2 sequenziato in Italia il 30 gennaio 2020:
CompleteGenome-CoV-2_30gen2020_ITA

E da qui potete scaricare tutti gli altri e anche costruire l’albero filogenetico che visualizza le sequenze di mutazioni che li collegano uno all’altro:
www.ncbi.nlm.nih.gov….coronavirus

Codici e sequenze

Tutti questi ATTAAAGGTTTATACCTTCCCAGGTAA ci fanno capire che un virus non è altro che un breve programma. Un codice ben più breve dei programmi che scriviamo su questo sito. Ma in compenso è un codice che si avvale di miliardi di anni di sperimentazione sul campo e quindi ha raggiunto una efficienza incredibile e riesce a fare cose inimmaginabili.

Una delle grandi cose che questo minuscolo esserino è già riuscito a fare, è stato di far chinare la testa a tutta l’umanità. Ci sta facendo capire che così non si può andare avanti, e se impareremo la lezione dovremo ringraziarlo.

Per ora il linguaggio di queste sequenze ci è in gran parte incomprensibile, ma siamo sulla buona strada e possiamo già fare alcune utili operazioni.

Analisi filogenetiche
Philogenetic map
Con il software open-source Nextrain si possono trovare indizi sullo sviluppo temporale dei virus.

Esempio di mappa filogenetica che mostra le mutazioni del SARS-CoV-2 e che ha permesso di stabilire che le prima versioni risalgono circa al dicembre del 2019.

Confronto tra le versioni

Tramite il confronto delle sequenze genetiche si possono fare ricerche di ogni genere. Ad esempio i ricercatori della School of Life Sciences dell’Università di Pechino e dell’Institut Pasteur di Shanghai, sotto la supervisione dell’Accademia cinese delle scienze, affermano di aver scoperto l’esistenza di due versioni di SARS-CoV-2.

Nel loro studio, pubblicato sulla National Science Review, il giornale della stessa Accademia delle scienze cinese, illustrano le due tipologie distinte di questo virus: una definita di Tipo-L, l’altra di Tipo-S.

Secondo il loro studio la prima, il Tipo-L, è risultata molto più contagiosa e letale della seconda.

Apparecchi fai da te

Trattare il DNA sta diventando sempre più semplice, al punto che alcuni apparecchi (ad esempio per la reazione a catena della DNA-Polimerasi) sono costruibili anche con il “fai da te”, ecco un esempio: Simple-PCR

Creare sequenze

Anche creare nuove sequenze e trasformarle in organismi reali sta diventando semplice. Con la biologia sintetica si creano geni da zero: “Digiti il ??DNA che desideri, lo stampi e lo trasformi in lievito”. Negli ultimi anni per un laboratorio medio, ordinare sequenze di DNA personalizzate da una società di sintesi è diventato un compito di routine: si inseriscono sequenze in un modulo online e si riceve il DNA per posta pochi giorni dopo.

Naturalmente puoi fare queste solo con organismi innocui come ad esempio i lieviti. Per trattare i virus dovresti far parte di un laboratorio certificato con biosicurezza di livello 3 o 4.   


Tecnologie pericolose 

Nel capitolo precedente abbiamo mostrato che pasticciare con le sequenze genetiche sta diventando facile e alla portata di tutti.

Biological LaboratoriesEd è ancora più facile nei laboratori che sviluppano armi biologiche.

Questi laboratori oltre che delle tecniche più avanzate di sequenziazione e sintesi, si avvalgono di super-computer in grado di creare miliardi di mutazioni al secondo.

E i computer possono anche simulare e selezionare i microorganismi con tecniche simili a quelle della selezione naturale.

Pertanto è abbastanza facile produrre sequenze sul computer
e farle sembrare mutazioni avvenute naturalmente, ad esempio nei pipistrelli.

La messa al bando delle armi chimiche e biologiche, imposta dal protocollo di Ginevra già nel 1925, non ha frenato la politica bellica di molti paesi (principalmente gli USA), che apertamente continuano a studiarle e a fabbricarle.   


Pericolo di censura

E’ prevedibile che qualcuno faccia obiezioni sul nostro diritto di proporre idee. Ad esempio esiste un “patto trasversale per la scienza” che utilizza metodi non scientifici (denunce alla magistratura) per oscurare i siti che pubblicano idee a loro non gradite. Questo “patto” è stato iniziato da Burioni, televirologo a reti unificate che nel 2009 non è riuscito nemmeno a superare un concorso pubblico (con appena 9 partecipanti complessivi, lui stesso incluso) all’ateneo di Camerino, per ricoprire il posto di “professore universitario”. E che nel 2010 è stato bocciato anche dall’università di Catanzaro e dalla Sapienza di Roma.

Ecco alcuni link che informano su Burioni e sul suo “patto”: LINK_1, LINK_2LINK_3, LINK_4, LINK_5, LINK_6, LINK_7 (interessante il link 7, che smonta pezzo per pezzo il libro di Burioni e la sua affermazione “La scienza non è democratica”).

Gli scienziati veri non utilizzano la televisione, le querele e le denunce, fanno ricerca nei laboratori e poi pubblicano i risultati. Saranno poi altri scienziati, e non il pubblico di Barbara D’Urso, a giudicare le loro idee con la “peer review”. Eppure Burioni (non si capisce come) è già riuscito parzialmente nel suo intento inquisitorio, perlomeno sui social degli Smart-Phones. Se ad esempio si apre il LINK_4 con WeChat, il sito di Radio Radio TV viene bloccato e appare questo messaggio di censura.

Dato che c’è il pericolo che i link precedenti vengano censurati, ecco i link ai video scaricabili da una fonte alternativa: LINK1LINK2LINK3,  LINK4, LINK5   


Terapie “fai da te”

Prima di tutto è importante chiarire che noi non vendiamo niente,
stiamo solo esponendo delle idee, potrebbero piacere o non piacere ma sono solo idee.

Ed è anche importante ricordare che
ciascuno ha il diritto di 
difendere la propria vita con ogni mezzo,
anche nel caso che questi mezzi non siano “ufficialmente riconosciuti”.

Attualmente avere fiducia nella medicina ufficiale può essere mortale, sia per il pericolo di venire contagiati negli ospedali, sia perché la maggioranza dei malati di Covid-19 non ricevono le cure necessarie. Gran parte di loro muoiono in corridoio, oppure a casa, o su una barella, o stanno una notte intera su una sedia, senza poter andare nemmeno in bagno (fuori servizio), senza pappagallo (nessuno li lava), senza cure intensive, senza ossigeno… vedere i video del prossimo capitolo.

Non stiamo accusando nessuno, anzi siamo sinceramente riconoscenti
per i sacrifici che stanno facendo medici e infermieri, grazie!

Ma ci teniamo anche a difendere il diritto di arrangiarsi con ogni mezzo,
nel caso i soccorsi non dovessero arrivare, o si venisse giudicati troppo anziani per meritarli. 
 


Testimonianze

Ecco alcune testimonianze sulla fine che hanno fatto decine di migliaia di persone nell’ultimo mese. Persone che hanno consegnato la propria vita, con fiducia, a chi non ha potuto salvarla:

SiroMarchesi,     Genova,     Medici,     SanRaffaele,    GiovanniBosco,    Zaninoni,     CartaBianca, Piemonte,    Italiano_in_Cina

Gli italiani che muoiono, non per il virus, ma per mancanza o lentezza delle cure, sono attualmente circa sei ogni dieci decessi, quindi oltre 500 ogni giorno (31 Marzo 2020). Questo dato è facilmente controllabile calcolando l’incremento di mortalità che c’è stato in Italia, secondo i dati della protezione civile e della organizzazione mondiale della sanità. Ecco come si fa:

  • Primo marzo 2020 –   1577 contagiati totali e    34 decessi – quindi il  2% di decessi
  • 10 marzo 2020    –  10149 contagiati totali e   631 decessi – quindi il  3% di decessi
  • 20 marzo 2020    –  47021 contagiati totali e  4032 decessi – quindi il  9% di decessi
  • 31 marzo 2020    – 105792 contagiati totali e 12428 decessi – quindi il 12% di decessi
  • 15 aprile 2020   – 165155 contagiati totali e 21645 decessi – quindi il 13% di decessi
  • 10 maggio 2020   – 219070 contagiati totali e 30560 decessi – quindi il 14% di decessi

Come si vede inequivocabilmente dai dati, all’inizio di Marzo la mortalità era del 2%, simile a quella cinese, tedesca e americana. Poi la mortalità è cresciuta fino al 14% (e sta continuando a salire, nota del 10 maggio 2020).

E in alcune regioni è anche maggiore, ecco ad esempio i conti per la Lombardia:

  • Primo marzo 2020 –    984 contagiati totali e    24 decessi – quindi il  3% di decessi
  • 10 marzo 2020    –   5791 contagiati totali e   468 decessi – quindi il  8% di decessi
  • 20 marzo 2020    –  22264 contagiati totali e  2549 decessi – quindi il 11% di decessi
  • 31 marzo 2020    –  43208 contagiati totali e  7199 decessi – quindi il 17% di decessi
  • 15 aprile 2020   –  62153 contagiati totali e 11377 decessi – quindi il 18% di decessi

Sono dati relativi alla sola Italia e rilevati nel giro di poche settimane con le stesse modalità (vedere qui). Quindi non si può dare la colpa a diversi metodi di valutazione tra i vari paesi. E nemmeno si può pensare ad altri fattori, quali l’alta percentuale di anziani o variazioni genetiche.

La mortalità aumenta quando non ci sono più posti, respiratori e ossigeno per tutti. Confermato anche da fonti ufficiali, nonché da medici, infermieri e pazienti, vedere i video proposti qui sopra.  


Cosa fare se i soccorsi non arrivano

Come mostrato nel capitolo precedente (se non lo avete ancora fatto guardate i video), un gran numero di persone sta morendo ogni giorno perché l’ossigeno non si trova, o perché arriva troppo tardi o perché si viene lasciati su una sedia, o su una barella in corridoio fino a che si diventa troppo gravi per potersi riprendere.

E anche se la crescita dei contagiati inizierà a rallentare, comunque la percentuale di mortalità aumenterà ancora per mesi e alla fine (entro qualche anno) il Covid-19 lo dovremo prendere quasi tutti. Per cui è bene abituarsi all’idea che qualcuno in famiglia, tra zii, fratelli nonni e cugini, o prima o poi lo prenderà.

E ci sarà anche qualche familiare che farà fatica a respirare e avrà bisogno dell’ossigeno per superare ì giorni peggiori. Per cui è bene cominciare a pensarci in tempo, prima che sia troppo tardi (guardate ad esempio il primo video tra quelli proposti nel capitolo precedente). 

Per piacere scrivete i messaggi alla fine di questa pagina.
Condividere le esperienze potrà essere utile ad altri
e in alcuni casi anche salvare delle vite!
  


Concentratori di ossigeno

Il Consiglio Superiore di Sanità ha dato il consenso alla somministrazione di ossigeno da parte di personale non medico e in questo documento dice testualmente: “L’ossigeno non è un farmaco la cui somministrazione è limitata al medico o al personale sanitario“.

Da Wikipedia: I generatori di ossigeno tramite sistema PSA rappresentano una fonte di ossigeno economicamente conveniente. Sono più sicuri, meno costosi, e tendenzialmente più convenienti rispetto ai serbatoi di ossigeno criogenico od alle classiche bombole di ossigeno liquido. … omissis …  I concentratori di ossigeno portatili risultano più efficaci nella terapia domiciliare per pazienti affetti da insufficienza respiratoria cronica: le bombole di ossigeno liquido (stroller) hanno un’autonomia limitata che costringe il paziente a ritornare al proprio domicilio dopo poche ore. I concentratori di ossigeno portatili invece permettono al paziente di non avere limiti temporali in quanto sistemi di auto-produzione utilizzabili con la batteria oppure ovunque vi sia una sorgente di alimentazione elettrica (220V o 12V).

Una domanda che ci stiamo facendo è: “Come mai data la tragica carenza di bombole che sta causando centinaia di morti ogni giorno, il servizio sanitario nazionale non acquista migliaia di concentratori di ossigeno da dare a chi non trova posto in terapia intensiva e sta morendo nelle case” ?  (chi non ci crede guardi i video del precedente capitolo testimonianze)

I concentratori di ossigeno costano poco (da 250 Euro in su). Non sono apparecchi professionali, ma funzionano e potrebbero salvare molte vite, ecco di cosa si tratta:
it.wikipedia.org/wiki/Concentratore_di_ossigeno


Modelli di concentratori di ossigeno

Esistono numerosi modelli di concentratori, ecco alcuni esempi scelti tra i più facilmente reperibili e tra i migliori come rapporto tra qualità e prezzo.

Per piacere scrivete i messaggi alla fine di questa pagina.
Condividere le esperienze potrà essere utile ad altri
e in alcuni casi anche salvare delle vite!

Oxygen concentrator

 

Questo modello costa meno di 200 Euro (dalla Cina), ma è veramente piccolo (35 x 23 x 28 cm). Eroga solo un litro al minuto per cui in casi gravi potrebbe essere insufficiente.

Consuma 125 Watt ed è abbastanza rumoroso (50 dB).

 

Oxygen concentrator

 

Questo è uno dei modelli meno costosi, lo si trova su eBay per 239 Euro, spedizione compresa. Le dimensioni sono di 21 x 21 x 30 cm e pesa 5.5 Kg

Produce da 1 a 6 litri al minuto (93% di concentrazione con un litro al minuto), consuma 120 Watt  e il rumore non è specificato.

Il timer è regolabile fino a 999 minuti (16 ore).

 

 

Oxygen Concentrator

.
Questo modello costa circa 230 Euro + 60 di spedizione (su eBay). Le dimensioni sono di 33 * 20 * 40 cm.

Il flusso di uscita va da 1 a 8 litri al minuto, il rumore dichiarato è 43 dB  e il consumo è 110 Watt.

Naturalmente, come tutti gli apparecchi piccoli, arriva al 93% di ossigeno solo con portate basse (1 litro al minuto).

 

Oxygen Concentrator

.
Questo modello costa circa 290 Euro (su eBay con spedizione compresa). Le dimensioni sono di 27 x 23 x 30 cm e pesa 5.8 Kg.

Il flusso di uscita va da 1 litro al minuto (93% di concentrazione) fino a 7 litri al minuto con concentrazione minore.

Il rumore non è specificato e il consumo è di 120 Watt.

Il timer è regolabile fino a 999 minuti (16 ore).

 

Oxygen concentrator

.
Questo modello costa circa 330 Euro (su eBay con spedizione compresa). Le dimensioni sono di 34 * 18 * 31 cm

Il flusso di uscita va da 1 a 6 litri al minuto, il rumore dichiarato è 45 dB  e il consumo è 100 Watt.

Arriva al 90% di ossigeno e solo con portate basse (1 litro al minuto). Il timer è regolabile con un massimo di 180 minuti.

 

Oxygen Concentrator

 

Questo modello costa circa 400 Euro (su Amazon con spedizione compresa). Le dimensioni sono di  28 * 18 * 34 cm e pesa 6.5 Kg.

Il flusso di uscita va da 1 litro al minuto, con il 93% di concentrazione, fino a 5 litri al minuto. Con 3 litri al minuto fornisce il 60% di concentrazione.

Il rumore è di 54 dB e il consumo è di 100 Watt.

Specificano di NON usarlo per più di otto ore di seguito.

 

 

Oxygen concentrator

Questo modello costa circa 270 Euro (senza atomizzatore) o circa 290 Euro (con atomizzatore) su eBay con spedizione compresa. Le dimensioni sono di 36 x 23 x 32 cm.

Il flusso di uscita va da 1 litro al minuto (93% di concentrazione) fino a 5 litri al minuto con concentrazione minore.

Il rumore è 45 dB e il consumo è di 120 Watt. C’è un timer strano che indicano con “ciclo di 15 minuti entro due ore” e che alcuni venditori dicono di non regolare a meno di 5 minuti, per non danneggiare il compressore.

 

Concentrator Display

I concentratori cinesi economici hanno ottimi display e controlli, spesso migliori anche dei modelli più costosi.

I display di tutti i modelli mostrano la percentuale di ossigeno, il flusso in litri al minuto e le ore e minuti del temporizzatore.

I comandi sono semplici, cinque pulsanti in tutto.

Cliccate sulla immagine per ingrandirla

 

Oxygen Concentrator

 

Questo è il “Philips Respironics Everflo”, lo si trovava su Amazon per 600 Euro, ma ora è “non disponibile”. Lo si trova da altri rivenditori e anche su eBay, ma a prezzi molto alti, 1500-2000 Euro e oltre. Le dimensioni sono 58 x 38 x 24 cm e il peso 14 Kg.

E’ regolabile da 2 a 5 litri al minuto, ha un rumore inferiore ai 40dB e consuma 295 Watt.

Riesce a concentrare l’ossigeno fino all’88% anche con la massima portata di 5 litri al minuto.

 

Oxygen Concentrator

 

Questo è il modello “OXY-Relief “, lo si trova presso vari rivenditori on-line per circa 800 Euro. Le dimensioni sono 38 x 35 x 66 cm e il peso 25 Kg.

E’ regolabile da 1 a 5 litri al minuto, ha un rumore inferiore ai 40dB e consuma 350 Watt.

Riesce a concentrare l’ossigeno fino all’93% ma non specificano a quale portata.

 

Oxygen ConcentratorQuesto è il “KRÖBER”, uno dei meno rumorosi anche tra i modelli più costosi, costa circa 1700 Euro. Le dimensioni sono 53 x 20 x 52 cm senza ruote, e il peso 16 Kg

Le caratteristiche sono ottime, consuma solo 280 Watt ed ha un rumore di soli 31 dB. Il flusso è regolabile da 1 a 5 litri al minuto e ha 30 mila ore di garanzia.

Riesce a dare fino all’85% di ossigeno anche con il massimo flusso, pesa solo 16 kg e ha addirittura l’interfaccia USB.

 

Esistono anche modelli più costosi, ad esempio lo “Inogen ONE” da oltre 3000 Euro, con caratteristiche speciali, ad esempio la batteria fino a 9 ore di autonomia. Caratteristiche che per il Covid-19 ci interessano poco.  


Maschere per Ossigenoterapia

Esistono vari metodi per somministrare l’ossigeno, dal meno invasivo (un doppio tubicino che si posiziona sotto al naso), fino alla alle maschere complete o addirittura agli scafandri che avvolgono tutta la testa.

Una soluzione intermedia, molto efficiente ma ancora ragionevolmente comoda da indossare, sono le maschere naso-bocca che si vedono nelle prossime immagini. Sorprendentemente il loro prezzo è molto basso, meno di due Euro complete di tubo e accessori. Ecco alcuni link dove trovarle: Link1 Link2

Oxygen Mask    Oxygen Mask with Reservoir

La prima a sinistra è più semplice e più comoda da indossare, ma ha lo svantaggio di perdere più di metà dell’ossigeno prodotto dall’apparecchio concentratore.

Quella a destra, chiamata “maschera ad alta concentrazione”, invia l’ossigeno che non si utilizza durante l’espirazione verso un sacchetto morbido, rendendolo poi disponibile in maggiore quantità durante l’inspirazione. Con questo modello si può regolare il concentratore di ossigeno per un flusso più basso.

Se ad esempio con la maschera semplice si dovesse regolare il concentratore al massimo (6 litri al minuto), con la seconda basterebbero da 2 a 3 litri al minuto.

Regolare un flusso più basso permette al concentratore di lavorare meglio, consumare meno, produrre una maggiore concentrazione di ossigeno e in molti casi anche essere meno rumoroso.        


Quanto ossigeno somministrare

Il Consiglio Superiore di Sanità ha dato il consenso alla somministrazione di ossigeno da parte di personale non medico e in questo documento dice testualmente: “L’ossigeno non è un farmaco la cui somministrazione è limitata al medico o al personale sanitario“.

Però è bene conoscere alcune regole fondamentali per evitare un sovra-dosaggio prolungato che potrebbe causare ipercapnia (respiro così lento da causare un aumento del livello di anidride carbonica), oppure un sotto-dosaggio e quindi una insufficiente ossigenazione dei tessuti.

I concentratori di ossigeno che abbiamo indicato nei capitoli precedenti non generano alti flussi (6-8 litri al minuto) con ossigeno al 100%, per cui sono abbastanza sicuri anche se regolati al massimo per lunghi periodi.

Però alcune persone (specialmente i forti fumatori) hanno una bronchite cronica (BPCO) e quindi una saturazione abituale molto bassa (88-92%). Queste persone, in presenza di una saturazione superiore al 92-95%, iniziano a respirare troppo lentamente e quindi non eliminano l’anidride carbonica in quantità sufficiente.

PulsiOxymeter
Sarebbe quindi utile disporre di un Saturimetro o PulsiOssimetro (li si trovano su eBay per una frazione di quello che costano in farmacia).

E sarebbe bene acquistarlo PRIMA di contrarre il Covid-19 in modo da conoscere la propria saturazione abituale. Così in caso di bisogno si saprà quale è la saturazione cui si dovrebbe tendere.

Misurando con un Saturimetro le saturazioni abituali dovrebbero essere:

  • Paziente con BPCO: target ideale di saturazione tra 88% e 92%
  • Paziente senza BPCO: target ideale di saturazione tra 94% e 98%.

Quando si misura con un Saturimetro (PulsiOssimetro) è bene tendere a una saturazione non superiore al 98% perché questi apparecchi non misurano la vera concentrazione nel sangue e quindi la loro scala di misura si ferma al 99%. Per cui, se si esagera con l’ossigeno, continuano a segnare 99% e non avvertono della eventuale presenza di PO2 pericolosamente alti (130-150 e oltre) e nemmeno di un eventuale accumulo di anidride carbonica nel sangue.

Saturation VS PO2

Questo grafico mostra che la saturazione misurata con un Saturimetro (PulsiOssimetro) si ferma al 99-100% anche in presenza di PO2 (pressione parziale arteriosa di ossigeno nel sangue) superiori a 100.

Concludendo, dato che non possiamo misurare la vera PO2 nel sangue (troppo invasivo), dovremo mirare alle concentrazioni spiegate in precedenza (tra 88% e 92% per pazienti con BPCO, e tra 94% e 98% per i pazienti senza BPCO).

Situazioni di emergenza

In caso di emergenza, quando i segni di ipossia (insufficienza di ossigeno) sono evidenti, non si deve perdere tempo con il saturimetro e con le considerazioni precedenti. In questi casi l’ossigeno va regolato al massimo, eventualmente utilizzando una maschera con il reservoir per aumentarne ulteriormente la concentrazione.

In caso di emergenza si deve al più presto richiedere un aiuto urgente. E durante l’attesa dei soccorsi è meglio esagerare con l’ossigeno, perché si farebbero più danni a non somministrarlo, piuttosto che somministrarne di più anche se non era necessario.   


Disposizione delle colonie di virus

Coronavirus Electronic Microscopy

In questa immagine si vede come il virus SARS-CoV-2 si riproduce in grandi quantità sulle cellule dei polmoni, fino a creare problemi alla respirazione.

Importante notare che le colonie di virus si trovano fuori dalle cellule polmonari,
nella zona esposta all’aria
.

La parte visibile di questa immagine è grande un centesimo di una pulce e i pallini arancioni (i virus) hanno un diametro di un decimillesimo di millimetro. I virus SARS-CoV-2 sono più piccoli dei fotoni (particelle di luce tramite i quali noi vediamo) e non li possiamo vedere nemmeno ingrandendoli mille volte con il migliore microscopio. Quindi questa immagine è stata fatta con un microscopio elettronico, utilizzando elettroni al posto della luce normale.

I virus tappezzano le cellule polmonari e data la loro posizione è difficile raggiungerli e inattivarli attraverso il sangue. I virus si trovano praticamente all’esterno dell’organismo, nella zona dove non c’è sangue ma aria, e i medicinali iniettabili non li raggiungono.  


Inattivazione dei virus

Nella prossima tabella vediamo che con 4 parti per milione di ozono si inattivano i virus in 20 minuti.
(dati da: Ministero della salute – CNSA – Ottobre 2010)

E nella tabella seguente si vede che si rimane nella regione “non tossica” anche respirando una concentrazione maggiore (5 parti per milione), per un tempo maggiore (30 minuti).
(dati da: https://www.lenntech.it/ozono-esseri-umani.htm)

Virus inactivation

 

Human-tolerance-for-ozone

Nei mesi passati abbiamo proposto idee riguardo a una possibile cura con ossigeno e basse concentrazioni di ozono, ma purtroppo la percentuale di ozono tossica è molto simile a quella efficace. Inoltre ultimamente (maggio 2020) sono state scoperte alcune cure valide e di sperimentata efficacia, per cui non ha più senso continuare con queste idee.

Resta comunque la possibilità di utilizzare l’ozono (e gli ultravioletti) per sterilizzare stanze e oggetti, come vedremo nelle prossime pagine.   


Sterilizzatori a Ozono

Il problema maggiore dell’ozono è che dopo aver riempito una stanza con un’alta concentrazione di ozono, poi ci vogliono giorni per farlo uscire dai materassi e dalle coperte. E durante quel tempo si rischia che la concentrazione sia ancora troppo alta per poterci dormire con sicurezza.

Come abbiamo visto nel precedente capitolo, se si soggiorna a lungo in una stanza con una percentuale di ozono troppo alta si potrebbero avere sintomi gravi e anche intossicazione. Per cui stiamo preparando un sensore semplice ed economico che misura la percentuale di ozono in PPM (parti per milione) con grande precisione.

ATTENZIONE: Utilizzare i generatori di ozono che si trovano in rete
senza misurare la concentrazione di ozono potrebbe essere pericoloso.

Un esempio di generatore di ozono:
https://www.ebay.it/itm/1-Pcs-10g-Portable-Car-Ozone-Generator-Ozonizer-Ceramic-Plate-Air-Sterilizer-12V-/254441329216


Sterilizzatore a ozono per oggetti

Un apparecchio interessante e sicuro potrebbe essere un armadio per sterilizzare oggetti o capi di abbigliamento. In questo caso l’ozono resterebbe sigillato e quindi si potrebbe utilizzare una concentrazione molto alta, ad esempio 100 ppm, con la quale otterrebbe una buona sterilizzazione in pochi minuti.

In questo caso l’ozono è migliore degli ultravioletti perché essendo un gas riesce ad arrivare anche nei punti che sarebbero in ombra per gli ultravioletti.

Questo apparecchio sarebbe costituito da:

  • Un armadio con chiusura ermetica e temporizzata.
  • Un generatore di ozono con una produzione di almeno 10 grammi per ora (li si trovano su eBay per circa 25 Euro).
  • Un sensore di ozono MQ131.
  • Un filtro con aspiratore per estrarre velocemente l’ozono senza immetterlo nell’ambiente.
  • Un MiniPC che misura la concentrazione di Ozono e stabilisce il tempo di chiusura.
  • Un modulo Theremino Master che legge il sensore e comanda il generatore, l’aspiratore e la elettrovalvola di chiusura della porta.

Esempio di calcolo del tempo:

  • Un armadio largo 50 cm, profondo 60 cm e alto 120 cm contiene 360 litri di aria.
  • L’aria pesa circa 1.3 grammi per litro per cui 360 litri fanno 468 grammi.
  • Cento parti per milione di 468 grammi fanno 0.0468 grammi.
  • Un generatore da 10 grammi per ora fa 0.16 grammi in un minuto.
  • Per cui per arrivare a una concentrazione di 100 ppm basterebbero meno di 20 secondi.
  • E per arrivare a 1000 ppm basterebbero meno di 180 secondi.

Con una concentrazione di 1000 ppm si disattiva oltre il 90% dei virus in circa cinque secondi, per cui si potrebbe stabilire un tempo di attività sovrabbondante, ad esempio due minuti, che darebbe una notevole sicurezza senza allungare troppo il ciclo di pulizia.

In conclusione si potrebbe utilizzare un ciclo di pulizia di cinque minuti, composto da 90 secondi di generazione dell’ozono, due minuti di attività e novanta secondi di estrazione dell’ozono.

IN COSTRUZIONE

… 


Inattivazione di batteri e virus

Coronavirus

 

Prima di procedere nella lettura vi consigliamo di  leggere queste pagine.

Lo studio che proponiamo, scritto da Pietro Semproni, fornisce nozioni approfondite sulle modalità di trasmissione dei virus e sugli effetti di inattivazione causati dagli ultravioletti.

 

Il grado di inattivazione da radiazione ultravioletta è direttamente correlato alla dose UV applicata. Il dosaggio, un prodotto dell’intensità della luce UV e del tempo di esposizione, viene solitamente misurato in microjoule per centimetro quadrato, o equivalentemente in microwatt per secondo al centimetro quadrato (µW · s / cm 2 ).

I dosaggi per l’uccisione del 90% dei batteri e l’inattivazione del 90% dei virus vanno da 2 a 8 mW per secondo al centimetro quadro. Quindi se contiamo 5 mW per centimetro quadro e una potenza di 5 Watt, si possono sterilizzare circa 1000 centimetri quadri in un secondo.

Calcolando le pareti di una stanza da 3 per 4 metri e alta 2.5 metri si ottengono 350 mila centimetri quadri. Sommando anche il soffitto e pavimento si arriva a 590 mila.

Per cui con 5 Watt si coprirebbero le pareti in 350 secondi, cioè circa 6 minuti. E considerando anche soffitto e pavimento si arriverebbe a 590 secondi, quindi poco meno di dieci minuti.

L’efficacia di questo metodo di sterilizzazione dipende anche dalla configurazione dell’ambiente, se ci sono ostacoli l’efficacia dipende dal punto in cui è posizionata la lampada UV. Un altro problema è la polvere o la sporcizia che possono ricoprire la lampada, riducendone l’effetto. Inoltre le lampade richiedono una sostituzione annuale e una pulizia ad intervalli regolari di tempo. Un aumento dell’efficacia può essere raggiunto utilizzando un riflettore parabolico. L’alluminio ha il più alto tasso di riflessione rispetto agli altri metalli, ed è molto utile per riflettere gli UV.


La lunghezza d’onda più efficace

Germicidal effectiveness

In questa immagine si vede che le lampade al mercurio a bassa pressione emettono tutta la loro potenza luminosa proprio nella zona di massima efficienza germicida e di inattivazione dei virus.

Ulteriori informazioni sull’effetto germicida della radiazione ultravioletta:
https://it.wikipedia.org/wiki/Radiazione_ultravioletta_germicida
https://en.wikipedia.org/wiki/Ultraviolet_germicidal_irradiation
http://www.cisuvc.com/content/documents/files/GermicidalPower.AN.10.27.pdf   


Uno sterilizzatore a raggi ultravioletti

Stiamo progettando un apparecchio per disinfettare le stanze (pareti, maniglie, pavimenti, soldi, oggetti, letti, termometri ecc..) per mezzo degli ultravioletti, una specie di XENEX da 120 mila dollari, ma molto più leggero, economico e maneggevole.

Ecco due link che mostrano lo XENEX, un baraccone così pesante e scomodo che rende impossibile sterilizzare alcune aree, ad esempio sotto i letti e altre superfici che restano in ombra:
http://www.xenex.com/our-solution/lightstrike
https://www.youtube.com/watch?v=Eh3fY6c7_FQ

L’apparecchio che stiamo progettando sarà più potente dello XENEX, ma maneggevole come una aspirapolvere, e permetterà (a una persona esperta e con tuta integrale) di disinfettare totalmente una stanza di ospedale in meno di dieci minuti.

Secondo i calcoli per disinfettare una grande stanza in dieci minuti servono circa 5 Watt di UVC. Quindi la versione grande, per gli ospedali, potrebbe avere una potenza (consumata) di 36 o 44 Watt e una resa di circa 12 o 15 Watt di UVC a 260 nm.

Partendo con una potenza doppia o tripla abbiamo un buon margine per compensare il graduale esaurimento della lampada e altre imprecisioni nel posizionamento o nei tempi di applicazione.

Questa versione dovrebbe contenere anche un computer e un sensore di distanza per aiutare l’operatore a coprire tutte le aree della stanza con il tempi giusti.

Questa versione potrebbe costare qualche migliaio di Euro.


Versione economica

Si potrebbe anche pensare e una versione ridotta con un emissione di pochi Watt UVC e senza computer. Questa versione economica potrebbe essere utile in casa per sterilizzare denaro, portafogli e altri oggetti.

Però mettere in mano a consumatori un apparecchio del genere potrebbe essere una cattiva idea, data la sua pericolosità. Un apparecchio destinato ai consumatori dovrebbe essere certificato CE, ma il marchio CE per sua natura certifica la “non pericolosità” di un prodotto e in questo caso non ci siamo proprio. Questo apparecchio è molto pericoloso, e deve esserlo.

Naturalmente chi lo costruisse per se stesso non avrebbe di questi problemi, vedremo…   


Progettazione dello sterilizzatore UVC

Abbiamo scoperto che le lampade al mercurio a bassa pressione sono notevolmente più efficienti e meno costose dei LED, per cui stiamo modificando il progetto.

LED_Xenon_IrradianceQueste NON sono le lampade allo Xenon usate dall’apparecchio XENEX che ci avevano ingannato per la loro scarsa efficienza. Aprite l’immagine qui di fianco che mostra come le lampade allo Xenon siano una decina di volte meno efficienti dei LED (alla lunghezza d’onda che ci interessa per inattivare i virus).

  • Efficienza delle lampade allo Xenon : inferiore allo 0.5%
  • Efficienza dei LED da 260 nm : meno del 2%
  • Efficienza delle lampade al mercurio a bassa pressione : oltre il 30%

MercuryLowPressure_UVC Spectrum

Come si vede nella immagine qui sopra le lampade al mercurio a bassa pressione emettono quasi tutta la loro energia in una riga sola intorno ai 254 nm.

Inoltre, a differenza delle lampade allo Xenon, queste lampade non producono ozono. Così un operatore potrebbe disinfettare molte stanze di seguito senza pericolo di intossicazione.

Infine queste lampade hanno una efficienza del 30%, quindi con 18 Watt di consumo producono 5.5 Watt di UVC tutti concentrati proprio sulla lunghezza d’onda che ha il massimo effetto di inattivazione dei virus. Da qui potete scaricare il DataSheet delle OSRAM da 18 Watt

– – – – –

PHILIPS 18 Watt UVC

 

Per ottenere una testa emettitrice sufficientemente maneggevole (larga circa 10 cm e lunga circa 25 cm) dovremo utilizzare due o tre lampade da 18 Watt affiancate, al posto di una da 36 o 55 Watt che sarebbe troppo lunga (oltre mezzo metro).

Le lampade più adatte appaiono quindi le “OSRAM HNS L 18 W 2G11” o le loro equivalenti “PHILIPS TUV PL-L 18 Watt”.

 


Progetto dei disinfettore a UVC

Stiamo procedendo con il progetto del disinfettore. Potremmo riuscire a farlo con le seguenti caratteristiche:

  • Completamente indossabile, senza la base a rotelle e  il cavo di rete.
  • Batteria intercambiabile al litio da 2 Kg, per tre ore di funzionamento attivo (una ventina di grandi stanze di ospedale)
  • Costo ragionevole.
  • Con circa 100 Euro di materiale si possono ottenere 15 Watt di UVC (che coprono una stanza 4 x 3 x 2.5 metri in meno di 3 minuti).
  • Con altri 100 Euro circa si aggiunge il mini-pc e il sensore di distanza.
  • Altri 100 Euro circa servono per ogni power-bank intercambiabile (da 12 Volt e 150 watt-ora).
  • Per cui con costruzione, collaudo e spese si dovrebbe stare nei mille euro.

Componenti:

  • MiniPC che calcola i giusti rapporti di distanza e tempo e aiuta l’operatore a non dimenticare delle zone (maniglia, pareti, zone in ombra sotto i letti, ecc…)
  • Sensore di distanza a ultrasuoni per aiutare l’operatore a mantenere una giusta combinazione di distanza e tempo.
  • Modulo ThereminoMaster che legge il sensore il sensore di distanza, legge un pulsante sul manico e accende e spegne le lampade .
  • Da una a tre lampade al mercurio a bassa pressione (si riducono i tempi fino a tre volte).
  • Alimentatori ballast da 12 volt e 18 watt, uno per ogni lampada.

Immagini dei componenti (fate click sulle immagini per ingrandirle):

PHILIPS 18 Watt UVC
Lampada da 18 Watt senza produzione di ozono, “OSRAM HNS L 18 W 2G11” o equivalente “PHILIPS TUV PL-L 18 Watt”.

Larghezza 10 cm e lunghezza circa 25 cm, per cui se ne potrebbero affiancare due o tre in una testa emettitrice di dimensioni ragionevoli. Il costo di tre lampade più tre zoccoli 2G11 e tre alimentatori “ballast”, si aggira sui 100 Euro.

 

Ballast 12v 18wAlimentatore “ballast” da 18 Watt, con alimentazione a 12 volt (da 10 a 15 volt) e 1.6 ampere. Efficienza del 90% e costo di circa 5 Euro su eBay.

I ballast potrebbero stare nella parte iniziale del manico per bilanciare il peso della testa emettitrice.

MiniPC con Windows 10
Un MiniPC Z85 con Windows 10, posizionato in uno zainetto sulla schiena, insieme al pacco batterie e ai piccoli componenti di controllo.

Il costo del MiniPC, compresi anche i piccoli componenti elettronici (Master e sensore di distanza) si aggira sui 100 Euro.

 

Power bank 150 Watt HourPacco batterie acquistabile già pronto (con certificazione CE), oppure si potrebbe costruirlo con batterie al litio e moduli di carica che si trovano su eBay.

Esistono numerosi modelli di Power Station simili a questo. I modelli da 150 Watt-ora costano poco più di 100 Euro, per cui conviene acquistarli già fatti.

Con 150 Watt-ora si alimentano tre lampade da 18 watt (più PC e elettronica) per oltre tre ore. Quindi si possono fare venti stanze prima di cambiare il pacco batterie.

– – – – –

IN COSTRUZIONE

Se qualcuno si proporrà per produrre questo apparecchio
noi contribuiremo gratuitamente
con la progettazione della elettronica di controllo e lo sviluppo del software.

– – – – – –

Pubblichiamo il progetto “Sterilizzatore a raggi ultravioletti” per avere la precedenza e impedire a chiunque di brevettarlo.

Noi siamo sempre per la libera circolazione delle conoscenze (vedere questa pagina) e non abbiamo nessuna intenzione di brevettare questa idea. Però questa pubblicazione la rende “arte nota”, per dirla nel gergo degli uffici brevetti, e quindi avremo sempre la precedenza e la possibilità di far decadere la validità di qualunque brevetto. 

Se in futuro qualcuno cercherà di brevettarlo, potremo dimostrare (per mezzo del sito web.archive.org) che oggi, il 25 Marzo 2020, questa idea era già pubblicata e quindi di pubblico dominio.    


Mascherine

Mask_OutsideBisognerebbe indossare una mascherina ogni volta che si esce di casa e questo diventerà anche più importante nei prossimi mesi. Già oggi in molti centri commerciali non si può nemmeno entrare senza una mascherina.

Con il coronavirus a piede libero è bene utilizzare mascherine adeguate. Tuttavia in questo periodo ci sono molte mascherine false in giro.

Per cui presentiamo 3 semplici test per controllare la qualità delle mascherine di tipo chirurgico.

Una mascherina chirurgica di buona qualità ha generalmente tre strati, con lo strato più interno che assorbe l’umidità, lo strato intermedio che fa da filtro e lo strato più esterno che respinge l’acqua.

Per eseguire i test è necessario sacrificare una mascherina. Quindi consigliamo di fare i test alla fine della giornata prima di buttare via la mascherina.

1) Test visivo

Se è una mascherina a 3 strati, logicamente, dovrebbe avere 3 strati. Tagliandola dovresti vedere 3 strati molto evidenti.

Mask_Inside

I 3 strati consistono in genere di un pezzo traslucido (in alto), bianco (al centro) e colorato (verde, blu, oppure bianco) .

2) Test dell’acqua

Le mascherine chirurgiche, non solo proteggono gli altri dalla tosse e dagli starnuti, ma forniscono anche protezione dagli altri. Pertanto, lo strato esterno è progettato per essere impermeabile.

Piega la mascherina in modo tale che il lato esterno formi un imbuto e versaci dentro dell’acqua. Dovresti essere in grado di vedere che la mascherina trattiene correttamente l’acqua. Dopo un certo tempo tocca il fondo dell’imbuto e assicurati che non sia bagnato o umido.

3) Test del fuoco

Lo strato intermedio deve essere un filtro, non un pezzo di carta. Pertanto con la fiamma di un accendino deve carbonizzarsi, ma non deve prendere fuoco come farebbe un normale pezzo di carta.  


Produzione delle mascherine

Il nostro collaboratore in Cina ha visitato una ditta che produce mascherine chirurgiche e pensava di proporle sul sito www.store-ino.com, costavano anche poco, ma purtroppo la spedizione verso l’Italia è risultata troppo costosa.

C’era quindi il rischio concreto di fare la figura degli approfittatori, per cui hanno deciso di lasciar perdere e l’unica cosa che possiamo proporvi e un video che mostra come vengono costruite.   

– – – – – –

Per piacere scrivete i messaggi alla fine di questa pagina.
Condividere le esperienze potrà essere utile ad altri
e in alcuni casi anche salvare delle vite!

  1. Marco Brianza says:

    mi stavo interessando alla sterilizzazione con UVC, siccome ho comprato su aliexpress alcune lampade UV sia a mercurio che LED volevo verificare il loro spettro, non ho capito se il vostro spettrometro arrivi fino a 250 nm.

    • Livio says:

      Il nostro spettrometro arriverebbe anche a 50 nm, ma non so dirti se esistono WebCam che vedono gli UVC. Ne abbiamo provate poche, molti anni fa e non avevamo LED UVC da provare.

      Comunque non hai bisogno dello spettrometro, le lampade al mercurio hanno lo spettro che vedi nella immagine del confronto con i LED, ecco il link diretto:
      https://www.theremino.com/wp-content/uploads/2020/03/LED_Xenon_Irradiance.png

      E i LED hanno la frequenza dichiarata e ti puoi fidare (se li compri direttamente dal costruttore).

      Le lampade al mercurio lasciale perdere perché non fanno abbastanza luce sui 260-270 nm, la fanno in altre aree e non serve a niente. Quindi o fai come XENEX (che usa lampade costosissime, da migliaia di Euro, e le tira per il collo con molti Kilo-Watt) o non ottieni niente.

      Per i LED il problema non è di misurare la frequenza ma i milliwatt emessi e su questo il nostro spettrometro non ti aiuterebbe. L’unico consiglio che posso darti è di acquistare i LED che consigliamo dalle ditte cinesi che abbiamo listato.

      Se trovi di meglio di quei LED scrivicelo che siamo interessati anche noi.

  2. marco says:

    grazie per la veloce risposta,
    le lampade a mercurio a bassa pressione mi sembrano abbastanza mirate per la produzione degli uvc ( ci sono varianti con e senza ozono) gli spettri qui http://www.tecnowattsnc.com/germlamp.htm

    il mio dubbio è sulla affidabilità di prodotti a LED cinesi ready made, che potrebbero non usare le frequenze corrette. per questo le volevo testare.

  3. Livio says:

    Le lampade al mercurio (anche se non sembra dagli spettri della pagina che hai indicato perché hanno appositamente schiacciato e reso invisibili le emissioni sulle altre frequenze) emettono gran parte della loro energia su frequenze che non hanno effetto germicida. Per cui a parità di effetto germicida ti servono 15 volte più Watt che con i LED.

    E per ottenere una rapida disinfezione di una stanza di Watt ne servono davvero molti, almeno 300..500 Watt con i LED e quindi 4500..7500 Watt con le lampade allo Xenon. Sempre che riesci a comprare lampade di quella potenza senza andare in miseria. E sempre che tu ti fidi ad accenderle sapendo che potresti perdere un capitale in pochi millisecondi nel caso l’alimentatore fosse sbagliato o difettoso.

    Inoltre le lampade a mercurio hanno una durata minore, sono più fragili e costano di più. E poi quando si rompono devi cambiare l’intera lampada con un costo pari al totale. Mentre se ti si rompono anche dieci LED su cento hai ancora il 90% della luce.

    Sui LED cinesi potresti avere ragione ma non a causa dei produttori. Potrebbe capitarti un venditore su eBay che ti vende i LED sbagliati. Ma purtroppo anche verificando che la frequenza fosse giusta (con il nostro spettrometro) non saresti mai sicuro dei milliwatt che tirano fuori.

    Per questo ti dicevo che l’unico modo sicuro è di comprarli direttamente dai produttori, in particolare da “Shenzen Yingfeng Opto-Electronic Co., Ltd” che per ora ci sembra il migliore.

    Uno del nostro gruppo (Leo) è in Cina e sta trattando con Yingfeng. Il problema non è solo comprarli ma anche saldarli su un PCB in alluminio da accoppiare a un dissipatore in grado di mantenere freddi i LED (massimo venti gradi oltre la temperatura ambiente) anche in presenza di potenze dissipate di centinaia di Watt.

    Appena riusciremo a mettere insieme qualcosa di buono lo scriveremo sul sito alla fine di questa sezione:
    https://www.theremino.com/video-e-notizie/coronavirus#disinfection

  4. marco says:

    Non capisco perchè parli di lampade allo xeno invece di lampade a vapori di mercurio. da questo altro grafico l’emissione delle mercurio a bassa pressione è prevalentemente a 254nm
    https://commons.wikimedia.org/wiki/File:Germicidal_Effectiveness_for_LP_%26_MP_mercury_lamp.png che è completamente differente da quella allo xeno da te indicata.

    • Livio says:

      Perché solo quelle allo Xenon sono abbastanza potenti da avere qualche effetto germicida. Quelle ai vapori di mercurio emettono così poca potenza UVC che per sterilizzare una stanza ci vorrebbero dei giorni.

      Facciamo qualche conto:
      – Per sterilizzare una stanza in dieci minuti ci vogliono circa 7 Watt di UVC
      – Per avere 7 Watt di UVC ci vogliono 500 Watt di LED con un rendimento dello 1.5 %

      Se trovi lampade ai vapori di mercurio abbastanza potenti e con un costo ragionevole metti un link al data-sheet e poi rifaremo insieme i conti.

    • Livio says:

      Non avevo guardato bene il link che hai mandato. Verso la fine ci sono i dati di potenza e sono potenze anche molto alte, ma c’e’ qualcosa che non mi quadra.

      Se le potenze ottenibili con le lampade ai vapori di mercurio sono davvero di molti Watt, allora come mai Xenex userebbe le costosissime e poco efficienti lampade allo Xenon nei suoi apparecchi da 120 mila dollari ?

      I Watt indicati nel link sono veri Watt di luce UVC a 370 nm, o forse quei valori (addirittura decine di Watt in alcuni casi) sono misurati in modo diverso?

      Oggi cercherò altri data-sheet di lampade ai vapori di mercurio per chiarire questi dubbi e se fossero Watt veri allora cambieremo direzione e elimineremo i LED dal progetto.

  5. ROBERTO BINI says:

    Buongiorno Livio, come sempre tanti complimenti per l’impegno messo a disposizione di noi tutti.
    Quando parli del fatto che un ozonizzatore non risulta idoneo in caso di superfici quali letti, cuscini e tessuti vari, in quanto l’ozono generato rimarrebbe intrappolato per lungo tempo al loro interno, posso chiederti da quali fonti hai ricavato tale indicazione? Ho visto che viene proposto/utilizzato per disinfezione di abitacoli di auto e mezzi pubblici e che ha un tempo di dimezzamento di 3 giorni allo stato gassoso ma viene indicato di attendere solamente qualche decina di minuti dopo il trattamento per la ricombinazione in ossigeno.

    • Livio says:

      Lo ha provato il nostro collaboratore Leo a casa sua e poi ha dovuto dormire in un’altra stanza. Sicuramente nel suo caso ne aveva prodotto troppo e per troppe ore, quindi forse potrebbe essere possibile trovare un giusto bilanciamento, ma non è facile andare a naso.

      Il problema è che la percentuale efficace (che si misura in PPM, parti per milione) è molto vicina a quella tossica per gli esseri umani.

      Per cui ci vuole un sensore di ozono MQ131 (pubblicheremo presto una applicazione che permette misurazioni precise e stabili con i sensori di gas MQ).

      E bisognerebbe utilizzare una concentrazione e un tempo sufficienti per inattivare i virus, ma senza esagerare, e mantenendo in movimento l’aria, con un ventilatore, in modo da avere la stessa concentrazione in tutti i punti della stanza.

Leave a Reply to Livio Cancel reply

Your email address will not be published.