Coronavirus

News Covid19

Questa pagina, creata nel 2020, raccoglie consigli e notizie sulla pandemia causata dal virus Covid19.

Nei prossimi anni questa pagina sarà sicuramente superata e non più aggiornata, ma la lasceremo comunque in ricordo di questo importante periodo storico.    


Il virus Covid19

Il codice genetico di questo virus è lungo poco meno di due milioni di lettere.

Inizia così:
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
e prosegue per una decina di pagine.

Esistono numerose varianti di questo virus. Basta una “a” o una “t” al posto di una “c” o una “g” e il virus non è più lo stesso, ma gran parte di queste mutazioni non modifica il suo funzionamento.

Ecco il codice completo del Wuhan-Hu-1, uno dei primi che sono stati sequenziati in Cina:
CompleteGenome-Wuhan-Hu-1

Questo è invece il Cov2 sequenziato in Italia il 30 gennaio 2020:
CompleteGenome-CoV-2_30gen2020_ITA

E da qui potete scaricare tutti gli altri e anche costruire l’albero filogenetico che visualizza le sequenze di mutazioni che li collegano uno all’altro:
www.ncbi.nlm.nih.gov….coronavirus

Si ma perché ?

Cosa ce ne facciamo di tutte queste lettere tipo ATTAAAGGTTTATACCTTCCCAGGTAA ?

Queste sequenze sono una premessa per capire che un virus non è altro che un breve programma. Un codice ben più breve dei programmi che scriviamo su questo sito. Ma in compenso è un codice che si avvale di miliardi di anni di sperimentazione sul campo e quindi ha raggiunto una efficienza incredibile e riesce a fare cose inimmaginabili.

Una delle grandi cose che questo minuscolo esserino è già riuscito a fare, è stato di far chinare la testa a tutta l’umanità. Ci sta facendo capire che così non si può andare avanti, e se impareremo la lezione dovremo ringraziarlo.

Per ora siamo ben lontani dal capire il linguaggio di queste sequenze ma siamo sulla buona strada e possiamo già fare alcune utili operazioni.

Analisi filogenetiche

Philogenetic mapCon il software open-source Nextrain si possono trovare indizi sullo sviluppo temporale dei virus.

Esempio di mappa filogenetica che mostra le mutazioni del Covid19 e permette di stabilire che le prima versioni risalgono circa al dicembre del 2019.


Sperimentare mutazioni

Creare nuove sequenze  …

…. la biologia sintetica riguarda la creazione di geni da zero: “digiti il ​​DNA che desideri, stampalo e lo trasformi in lievito”. In effetti, per il lavoratore di laboratorio medio, ordinare sequenze di DNA personalizzate da una società di sintesi è diventato un compito di routine: inseriamo sequenze in un modulo online e riceviamo il DNA per posta pochi giorni dopo. Ma come possiamo capire quale DNA digitare?…..

IN COSTRUZIONE


Colonie di virus

Coronavirus Electronic Microscopy

In questa meravigliosa immagine fatta con il microscopio elettronico si vede come il virus può riprodursi in grandi quantità sulle cellule dei polmoni, fino a creare problemi alla respirazione.

La parte visibile di questa immagine è grande meno di un millesimo di una pulce e i pallini arancioni (i coronavirus) hanno un diametro medio di un milionesimo di millimetro.    


Mascherine

Mask_OutsideBisognerebbe indossare una mascherina ogni volta che si esce di casa e questo diventerà anche più importante nei prossimi mesi. Già oggi in molti centri commerciali non si può nemmeno entrare senza una mascherina.

Con il coronavirus a piede libero è bene utilizzare mascherine adeguate. Tuttavia in questo periodo ci sono molte mascherine false in giro.

Per cui presentiamo 3 semplici test per controllare la qualità delle mascherine di tipo chirurgico.

Una mascherina chirurgica di buona qualità ha generalmente tre strati, con lo strato più interno che assorbe l’umidità, lo strato intermedio che fa da filtro e lo strato più esterno che respinge l’acqua.

Per eseguire i test è necessario sacrificare una mascherina. Quindi consigliamo di fare i test alla fine della giornata prima di buttare via la mascherina.

1) Test visivo

Se è una mascherina a 3 strati, logicamente, dovrebbe avere 3 strati. Tagliandola dovresti vedere 3 strati molto evidenti.

Mask_Inside

I 3 strati consistono in genere di un pezzo traslucido (in alto), bianco (al centro) e colorato (verde, blu, oppure bianco) .

2) Test dell’acqua

Le mascherine chirurgiche, non solo proteggono gli altri dalla tosse e dagli starnuti, ma forniscono anche protezione dagli altri. Pertanto, lo strato esterno è progettato per essere impermeabile.

Piega la mascherina in modo tale che il lato esterno formi un imbuto e versaci dentro dell’acqua. Dovresti essere in grado di vedere che la mascherina trattiene correttamente l’acqua. Dopo un certo tempo tocca il fondo dell’imbuto e assicurati che non sia bagnato o umido.

3) Test del fuoco

Lo strato intermedio deve essere un filtro, non un pezzo di carta. Pertanto con la fiamma di un accendino deve carbonizzarsi, ma non deve prendere fuoco come farebbe un normale pezzo di carta.  


Sterilizzatori a ozono

Abbiamo già scartato l’ozono perché troppo tossico per gli uomini. Il suo problema maggiore è che dopo aver riempito una stanza di ozono, in concentrazione sufficiente per eliminare tutti i virus, poi ci vogliono giorni per farlo uscire dai materassi e dalle coperte. E in quei giorni non ci puoi dormire altrimenti ti viene la tosse.

Un esempio di generatore di Ozono:
https://www.ebay.it/itm/1-Pcs-10g-Portable-Car-Ozone-Generator-Ozonizer-Ceramic-Plate-Air-Sterilizer-12V-/254441329216


Sterilizzatori a raggi ultravioletti

Stiamo progettando un apparecchio per disinfettare le stanze (pareti, maniglie, pavimenti, soldi, oggetti, letti, termometri ecc..) per mezzo degli ultravioletti, una specie di XENEX da 120 mila dollari, ma molto più leggero, economico e maneggevole.

Ecco un link dove si può vedere lo XENEX, un baraccone così pesante e scomodo che rende impossibile sterilizzare alcune aree, ad esempio sotto i letti e altre superfici che restano in ombra:
http://www.xenex.com/our-solution/lightstrike

L’apparecchio che stiamo progettando sarà notevolmente più potente dello XENEX, ma maneggevole come una aspirapolvere, e permetterà (a una persona esperta e con tuta integrale) di disinfettare totalmente una stanza di ospedale in meno di dieci minuti.

Dna Killer1Questa immagine è solo un “concept”, il progetto definitivo avrà il tubo più sottile e l’emettitore di ultravioletti più grande.

Si potranno fare due versioni di questo apparecchio.

La versione più grande, per gli ospedali, dovrebbe avere una potenza (consumata) di un centinaio di Watt e una resa a 270 nm di circa 1500 mW di UVC a 270 nm.

Questa versione dovrebbe contenere anche un computer che misura la distanza e i tempi e aiuta l’operatore a coprire tutte le aree della stanza con il tempo giusto. Questa versione potrebbe costare qualche migliaio di Euro.

Dato che i led a 265 nanometri costano molto si potrebbe anche pensare e una versione ridotta con un emettitore da una decina di Watt e senza computer. Questa versione economica potrebbe essere utile in casa per sterilizzare denaro, portafogli e altri oggetti.

Però mettere in mano a consumatori un apparecchio del genere potrebbe essere una cattiva idea, data la sua pericolosità. Un apparecchio destinato ai consumatori dovrebbe essere certificato CE, ma il marchio CE per sua natura certifica la “non pericolosità” di un prodotto e in questo caso non ci siamo proprio. Questo apparecchio è molto pericoloso, e deve esserlo.

Naturalmente chi lo costruisse per se stesso non avrebbe di questi problemi, vedremo…


Inattivazione di batteri e virus

Il grado di inattivazione da radiazione ultravioletta è direttamente correlato alla dose UV applicata.

Il dosaggio, un prodotto dell’intensità della luce UV e del tempo di esposizione, viene solitamente misurato in microjoule per centimetro quadrato, o equivalentemente in microwatt secondi per centimetro quadrato (μW · s / cm 2 ).

I dosaggi per un’uccisione del 90% della maggior parte dei batteri e virus vanno da 2 a 8 mW per secondo / al centimetro quadro. Quindi se contiamo 5 mW per centimetro quadro e una potenza di 1500 mW, si possono sterilizzare circa 300 centimetri quadri in un secondo.

Le pareti di una stanza da 3 per 4 metri e alta 2.5 metri fa 350 mila centimetri quadri e quindi ci vogliono circa 1200 secondi, cioè 20 minuti.

Con questo calcolo abbiamo appena scoperto che i 100 watt che avevamo preventivato non bastano. Per sterilizzare una stanza in un tempo ragionevole (dieci minuti) sarebbe meglio disporre di almeno 300 se non 500 Watt (di consumo).  E quindi il prezzo dei soli LED salirebbe a circa 600…1000 Euro. E il costo totale della testa irraggiante (considerando anche i dispositivi di raffreddamento) diventerebbe di circa 800…1500 Euro.


La lunghezza d’onda più efficace

Germicidal effectivness curve

In questa immagine si vede che la maggiore efficienza si ottiene nella zona tra 260 e 270 nm (curva tratteggiata).  La curva in nero mostra che l’emissione di un tipico LED da 265 nm si trova proprio nella zona di massima efficacia.

Ulteriori informazioni sull’effetto germicida della radiazione ultravioletta:
https://it.wikipedia.org/wiki/Radiazione_ultravioletta_germicida
https://en.wikipedia.org/wiki/Ultraviolet_germicidal_irradiation
http://www.cisuvc.com/content/documents/files/GermicidalPower.AN.10.27.pdf


 Confronto tra le lampade UVC e i LED a 270 nm

LED_Xenon_Irradiance

Questa immagine mostra una comparazione tra le lampade allo Xenon (quelle usate dall’apparecchio XENEX) e i LED UVC.

Nella immagine si vede che le lampade distribuiscono gran parte della loro potenza in aree dove la efficienza germicida è praticamente zero. Per cui, a parità di potenza consumata dalla rete, i LED sono almeno 15 volte più efficienti.

Quindi un apparecchio come lo XENEX conlampada UVC, deve consumare circa 7500 Watt per avere la stessa efficienza di un apparecchio a LED da 500 Watt.

Inoltre le lunghezze d’onda sotto ai 250 nm hanno anche il “brutto vizio” di produrre Ozono, che è tossico. Fortunatamente i LED non lo producono e quindi appena terminata la sterilizzazione la stanza è immediatamente abitabile, senza nemmeno farle prendere aria.

Infine le lampade UVC allo Xenon hanno una durata dalle 400 alle 5000 ore, mentre quella dei LED va dalle 3000 alle 8000 ore.


Caratteristiche dei LED

Questo documento raccoglie le caratteristiche dei LED più adatti che abbiamo trovato finora:
https://www.theremino.com/files/Coronavirus/UVC_LEDS/UVC_LEDS.txt

Per chi volesse le caratteristiche complete di ogni modello, ecco un file compresso che contiene i data-sheet di tutti i LED listati nel documento precedente:
https://www.theremino.com/files/Coronavirus/UVC_LEDS/UVC_LEDS_DataSheets.zip

IN COSTRUZIONE

Comments are closed.